ID: 1130370851

View in Genome Browser
Species Human (GRCh38)
Location 15:83284471-83284493
Sequence TGTGCGCGGAGCAGGCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 213}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370851_1130370856 0 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370851_1130370857 1 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370851_1130370863 18 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370851_1130370855 -3 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370851 Original CRISPR TGTGCGCGGAGCAGGCGGCC CGG (reversed) Intronic
900181383 1:1312543-1312565 GGTGCTCGGGGCAGGCGGCTGGG - Intronic
900526953 1:3134101-3134123 TGTGTCGGGAGCAGGAGGCCTGG + Intronic
900632669 1:3645299-3645321 TGTGCGCGGCGCAGCGGGACGGG + Intronic
900632699 1:3645413-3645435 TGTGCGCGGCGCAGCGGGACGGG + Intronic
900953688 1:5874062-5874084 TGTGCGGGGAGCATGCGTGCAGG - Intronic
901055576 1:6447389-6447411 GGGGCGCGGAGCGGGCGGGCTGG + Intronic
902478815 1:16701248-16701270 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
903674759 1:25056629-25056651 TGTGGGGGGTGCAGGTGGCCAGG + Intergenic
905626004 1:39491195-39491217 TCTGCCCGCAGCAGCCGGCCCGG - Intergenic
905752366 1:40477262-40477284 TGTGGGCGGAGCCGGCGGCCGGG + Exonic
905789702 1:40783668-40783690 AACGCGCGGAGCAGGCGGCGGGG - Intergenic
905910032 1:41647372-41647394 TGTGTGCTAAGCAGGCAGCCAGG - Intronic
907080363 1:51616363-51616385 TGTGCGTGGAGCAGTGAGCCAGG - Intronic
910936206 1:92485792-92485814 GGGGCGCGCAGCAGGCGGTCTGG - Intronic
915440917 1:155945015-155945037 GCTGGGCAGAGCAGGCGGCCTGG + Intergenic
916787281 1:168095786-168095808 TGTGCCAGGAGAAGGTGGCCTGG + Intronic
918215872 1:182391680-182391702 TGGTCGCCGAGCAGGCGGGCGGG + Exonic
920333380 1:205228136-205228158 GGGGCGCGGGGCAGCCGGCCGGG - Intergenic
921909052 1:220528175-220528197 TGCGCGCGGAGCAGCGGGCGCGG - Intronic
922533617 1:226363624-226363646 GGTGAGTGGAGGAGGCGGCCTGG + Intronic
922676814 1:227558579-227558601 TGTGCGGGGAGCGGCGGGCCAGG + Intergenic
1062774642 10:135344-135366 TTCGCGCGGAGCCGGCGGCGGGG + Intronic
1064353253 10:14596070-14596092 TGTGGGAGGAGCCAGCGGCCAGG - Intronic
1066022881 10:31319966-31319988 TGTGCGCGCCGCGGGCGGACAGG + Intronic
1066602744 10:37125527-37125549 GGTGCCCGGAGAACGCGGCCAGG + Intergenic
1069589362 10:69632229-69632251 GGTGGGCGGATCAGGAGGCCAGG + Intronic
1070741223 10:78904453-78904475 TGTGCTCAGAGCAGGAAGCCGGG - Intergenic
1073207229 10:101775708-101775730 GGTGCGCGGAGGCGGGGGCCGGG - Intronic
1073268186 10:102240996-102241018 AGGGCACGGGGCAGGCGGCCAGG - Intronic
1074585996 10:114768208-114768230 GCTGCGCGGAGCGGGCGGCCAGG - Intergenic
1076506020 10:130973197-130973219 TGTGCGCAGAGGAGGCCGCCAGG - Intergenic
1076852444 10:133099704-133099726 TGTGCGGGGAGGAGCCGCCCCGG - Intronic
1076852779 10:133101232-133101254 GGTGGGCGGGGCAGGCGGGCAGG - Intronic
1076879008 10:133230941-133230963 GGAACGCGGAGCAGGCGGTCGGG - Intronic
1077459451 11:2701327-2701349 TGTGGGCTGAGCAGGAGGCAGGG - Intronic
1078406369 11:11073730-11073752 TGTCCACAGAGCAGGCAGCCAGG + Intergenic
1078720025 11:13875756-13875778 TGTCCTCGGAGCACGCGGACAGG - Intergenic
1081662099 11:44894538-44894560 TCTGCACGGAGCAGGGGCCCAGG - Intronic
1083560816 11:63671610-63671632 TGTGCGCGAAGCGAGCCGCCGGG + Exonic
1083849087 11:65354959-65354981 TGGGTGCGGAGCGGGAGGCCGGG + Intronic
1084601223 11:70147101-70147123 TGTGCGTGGAGCAGCCCTCCCGG + Intronic
1084632438 11:70362457-70362479 TGTGGGCGGGGCAGACGGGCTGG - Exonic
1084777461 11:71387037-71387059 TGTGGGCGGGGCAGGGGGGCGGG - Intergenic
1085423096 11:76380717-76380739 CGGGCGCAGAGCGGGCGGCCCGG - Intronic
1087634523 11:100687500-100687522 TGAGCCCGGCGCAGGCGGCGCGG + Intergenic
1090850011 11:130563887-130563909 TGTGAGGGGAGCAGGGGACCAGG + Intergenic
1092108928 12:5945360-5945382 GCTGCGCGGCGCCGGCGGCCGGG - Intronic
1092123191 12:6058522-6058544 TGTGGGCCCAGCAGGCTGCCAGG + Intronic
1092146275 12:6216794-6216816 TGTGATCGGAGAAGGCGGCTGGG - Intronic
1094174119 12:27524262-27524284 TGTGCTGCGAGCTGGCGGCCGGG + Exonic
1094377114 12:29801965-29801987 TGGGGGCGCTGCAGGCGGCCGGG + Intergenic
1096094512 12:48925432-48925454 TGGGCGCGGGGCAGGGAGCCGGG + Exonic
1099890169 12:88580506-88580528 CGTGTCCGGAGCAGGCGGGCGGG - Intronic
1100329744 12:93571855-93571877 TGTCCGCTGAGGAGGCTGCCTGG + Exonic
1100771588 12:97928740-97928762 TGTGTGTGGAGCAGGGGGCATGG + Intergenic
1102025791 12:109713858-109713880 TCTCCGCGGAGCAGCCGGCCAGG - Intergenic
1103020012 12:117526328-117526350 TGTGGGAGCAGCAGGTGGCCAGG + Intronic
1103407769 12:120687572-120687594 TGTGCTGGGCGCAGCCGGCCGGG + Intronic
1103856383 12:123973307-123973329 GGTGCGCGGCGCCCGCGGCCTGG + Exonic
1104912734 12:132247528-132247550 AGTGCGCTGAGCAGGAGCCCTGG + Intronic
1107133446 13:36920083-36920105 GGCGCTCGGAGCGGGCGGCCGGG - Intronic
1113082307 13:106533148-106533170 AGTGGCTGGAGCAGGCGGCCTGG + Intronic
1113417339 13:110138489-110138511 TGCGCGCGGGGCAGGCGGGCGGG + Intergenic
1113896249 13:113766261-113766283 AGTGCGCCGGGCGGGCGGCCTGG + Intronic
1122747890 14:103910463-103910485 TGGGCGAGGAGCACGGGGCCAGG - Intergenic
1123739985 15:23226574-23226596 GGTGGGCGGAGCCGGCGGCCTGG + Intergenic
1124291209 15:28455542-28455564 GGTGGGCGGAGCCGGCGGCCTGG + Intergenic
1128145607 15:65330945-65330967 TGTGCGCTGTGCAGGGTGCCCGG - Intronic
1129457606 15:75683986-75684008 TGTGCCCGTAGCGGGTGGCCTGG - Intronic
1130370851 15:83284471-83284493 TGTGCGCGGAGCAGGCGGCCCGG - Intronic
1131091751 15:89629159-89629181 TGCAGGCGGGGCAGGCGGCCAGG + Intronic
1132114656 15:99126507-99126529 GGTGAGCAGAGCAGGTGGCCTGG + Intronic
1132484147 16:181462-181484 TCTGCGCCGAGCACGCGGCCCGG + Intergenic
1132513417 16:354750-354772 TGTGCTCAGAGCAGGTGGGCAGG + Intergenic
1132540490 16:506361-506383 TGTGGGCAGAGGAGGCAGCCAGG + Intronic
1132761491 16:1510574-1510596 TGTGTGGGGAGCAGGGGGGCAGG + Exonic
1132802164 16:1759762-1759784 TGTGCACAGAGCAGGCTCCCAGG - Intronic
1132884932 16:2178451-2178473 TGGGCGCGGCGCGAGCGGCCGGG - Exonic
1132899491 16:2245390-2245412 TGTGCGAGGAGGAGGCGGCTGGG + Intronic
1132978347 16:2721388-2721410 GGGGCGCGGCGCGGGCGGCCAGG + Intergenic
1134443184 16:14311455-14311477 TGTGTGCGGAGCTGGGTGCCAGG + Intergenic
1136277506 16:29187596-29187618 TGTGTGCCTTGCAGGCGGCCTGG - Intergenic
1136553292 16:30993108-30993130 GGTGAGCGGGGCAGGCGGCCTGG - Exonic
1136707562 16:32202122-32202144 GGTGGGCGAAGCCGGCGGCCTGG - Intergenic
1136760348 16:32727288-32727310 GGTGGGCGAAGCCGGCGGCCTGG + Intergenic
1136807756 16:33143098-33143120 GGTGGGCGAAGCCGGCGGCCTGG - Intergenic
1138340690 16:56287157-56287179 TGTGGCCGCAGCAGGGGGCCAGG + Intronic
1139354871 16:66361423-66361445 GGTGCCCGGAGGAGGTGGCCTGG - Intergenic
1141608645 16:85169443-85169465 TGGGCGCGGCGGCGGCGGCCTGG + Intergenic
1141697084 16:85625219-85625241 TGTGTGCGGAGAAGCAGGCCGGG - Intronic
1142081884 16:88153638-88153660 TGTGTGCCTTGCAGGCGGCCTGG - Intergenic
1142388149 16:89780091-89780113 TGTGCGCACAGCAGGGGCCCTGG + Intronic
1203062502 16_KI270728v1_random:987610-987632 GGTGGGCGAAGCCGGCGGCCTGG + Intergenic
1142470774 17:162045-162067 TGGGGAGGGAGCAGGCGGCCTGG + Intronic
1142671934 17:1491537-1491559 GGTGTGGGGAGCGGGCGGCCGGG - Intronic
1143078454 17:4365346-4365368 TGTGCGCGGAGCATGCGCAGTGG - Intronic
1146126584 17:30235969-30235991 GGAGCGCGGAGCAGCCGGCAGGG + Intronic
1146920036 17:36704094-36704116 TGTGGGTGGGGCAGGCGACCGGG + Intergenic
1146943081 17:36857304-36857326 TGTGAGCTGGGCAGGCGGGCAGG - Intergenic
1147259008 17:39197758-39197780 TGTGCGCCGAGCCGGCGGAGGGG - Intergenic
1148139188 17:45316618-45316640 GGGGCGCAGAGCAGGCGGGCGGG + Intronic
1148573680 17:48691836-48691858 TAAGCGGGGAGCAGGAGGCCAGG - Intergenic
1148593041 17:48830977-48830999 TGTGGGCGGGGCAGGCGGGACGG + Intronic
1148683975 17:49490500-49490522 TCTGCCCCGGGCAGGCGGCCAGG - Intergenic
1148698656 17:49575741-49575763 AGCGCGGGGAGCGGGCGGCCGGG + Intergenic
1151729244 17:75901160-75901182 GGTGAGCGGGGCAGGAGGCCTGG + Intronic
1151828598 17:76537252-76537274 GGTCGGCGGAGCAGGCGGCGTGG - Intronic
1152426419 17:80220756-80220778 TGTGGGCGGGGCCGGGGGCCGGG + Intronic
1152861427 17:82698639-82698661 TGAGCGCAGAGGCGGCGGCCCGG + Exonic
1152917849 17:83051334-83051356 GGAGCGCGGGGCAGGCGGGCGGG + Intronic
1152924134 17:83079820-83079842 GGGGCGCGGCGCGGGCGGCCTGG + Exonic
1152970760 18:158826-158848 GGTGCGCGGGGCCGGCGGCGCGG + Intronic
1154502885 18:15005298-15005320 TGTGGGCAGAGCAGGTGGCCAGG + Intergenic
1156457465 18:37302796-37302818 GGTGCGGGGAGCAGGCAGGCTGG + Intronic
1160035364 18:75296717-75296739 TGTGTGCAGAGCAGGGGGACGGG + Intergenic
1160701816 19:511204-511226 TGGGCTCGGAGGAGGAGGCCGGG - Intronic
1160793322 19:932943-932965 TGTGTGAGGAGCACCCGGCCGGG + Intronic
1160995605 19:1880768-1880790 GGTGCCAGGAGCAGGTGGCCAGG + Intronic
1161153462 19:2721110-2721132 TGAGCGCGGAGGGGCCGGCCGGG + Intronic
1161443439 19:4305047-4305069 TGGCCGCGGACCAGGCGTCCCGG + Intronic
1161468704 19:4445936-4445958 TGTTCTCAGAGCAGGGGGCCTGG - Intronic
1162727067 19:12696151-12696173 GGTGCGCGGGGCCGGGGGCCGGG - Exonic
1163390371 19:17026903-17026925 GATGGGCGGAGCAGGCGTCCCGG - Intergenic
1163681174 19:18683551-18683573 TGAGCGCGGCGCAGGCGCACAGG - Intergenic
1165075989 19:33280168-33280190 TGTGCGCCAAGCAGCAGGCCAGG - Intergenic
1166997074 19:46724742-46724764 TGTGCGTGGAGGGGACGGCCAGG + Intronic
1167818457 19:51904832-51904854 TGTGGGGAGAGCTGGCGGCCTGG - Intronic
1168293901 19:55369724-55369746 TGTGCGAGGCGCGGGCGGCCGGG - Intronic
1202712834 1_KI270714v1_random:27079-27101 GGGGCGCGGAGCCGGCGGGCTGG - Intergenic
925171206 2:1751264-1751286 TGTGTGCAGAGAAGGGGGCCCGG - Intergenic
925461402 2:4066404-4066426 TGTGAGAGGAGAAGGAGGCCTGG + Intergenic
925901725 2:8513826-8513848 TGGGCACGAAGCAGGGGGCCGGG + Intergenic
928186467 2:29115470-29115492 CGCGCGCAGTGCAGGCGGCCGGG - Exonic
930071607 2:47370082-47370104 CCTGCGCGCGGCAGGCGGCCCGG + Intronic
931116589 2:59172885-59172907 AGTGGGCGGATCAGGAGGCCAGG - Intergenic
932599256 2:73112742-73112764 GGGGCGCGGAGCCGGCGGCGGGG - Exonic
932621831 2:73269340-73269362 AGGGCAAGGAGCAGGCGGCCGGG - Exonic
934567872 2:95350574-95350596 TGGGCACCGAGCAGGGGGCCCGG + Intronic
934942113 2:98510228-98510250 TGTGAGAGGAGGAGGAGGCCAGG + Intronic
934966804 2:98730947-98730969 TGGGGGCGGCGCCGGCGGCCGGG - Intronic
936049850 2:109214349-109214371 TGTGGGGGCAGCAGGAGGCCGGG + Intronic
938178400 2:129157431-129157453 TGGGCGCTGAGCAGGCTTCCTGG - Intergenic
938252118 2:129823268-129823290 GGTGAGAGGAGCAGGAGGCCAGG + Intergenic
938337328 2:130511427-130511449 TGTGCGCGGAGGAGGGGCCTTGG - Intergenic
938352510 2:130609308-130609330 TGTGCGCGGAGGAGGGGCCTTGG + Intergenic
938403877 2:131016444-131016466 TGGGCAGGGTGCAGGCGGCCTGG - Intronic
938502051 2:131835468-131835490 TGTGGGCAGAGCAGGTGGCCAGG + Intergenic
939151039 2:138473004-138473026 GGTGGGCGGATCAGGAGGCCAGG - Intergenic
942280571 2:174359187-174359209 TGTGGGAGGAGAAGGCAGCCTGG + Intronic
944933677 2:204545672-204545694 TGGGCGCGGAGCAGCCGCCTGGG + Intergenic
946196571 2:218035763-218035785 TGTGGGGGGAGCAGGGTGCCTGG - Intronic
946200853 2:218069929-218069951 TGTGTGGGGAGCAGGGCGCCTGG - Intronic
946201208 2:218071842-218071864 TGTGTGGGGAGCAGGGTGCCTGG - Intronic
946351733 2:219160006-219160028 TGTGGTGGGAGCAGGCAGCCGGG - Intronic
946747486 2:222860889-222860911 GGAGCGCGGCGCTGGCGGCCCGG - Intergenic
948991599 2:241558614-241558636 TGCGCCCGGAGAAGGCGACCAGG - Intergenic
1169143672 20:3239322-3239344 AGGGCGCGGGGCGGGCGGCCGGG - Intergenic
1172118009 20:32583415-32583437 TGAGCGCGGGGCGGGCGGGCCGG + Intronic
1172502062 20:35434467-35434489 TGTGCCTGGAGCTGGAGGCCTGG - Exonic
1173953278 20:47010326-47010348 TGTGCTCGCAGCAGGTGGGCTGG + Intronic
1174013918 20:47472629-47472651 TGTGTGGGGAGCAGGGGGGCAGG - Intergenic
1175507349 20:59495325-59495347 TGTGGGTGGAGCAGGAGGTCAGG - Intergenic
1176062638 20:63178992-63179014 TGTCCGCGGTGCTGGCGGCGGGG + Intergenic
1176429098 21:6565078-6565100 GGTGAGCGCAGCAGGCAGCCAGG - Intergenic
1178951485 21:36989778-36989800 TGGGCGCGGGGCACGCGGCCAGG + Intronic
1179704588 21:43173394-43173416 GGTGAGCGCAGCAGGCAGCCAGG - Intergenic
1179944947 21:44666835-44666857 TGGGCGCGCAGCAGGCTGGCTGG + Exonic
1179946574 21:44682072-44682094 TGGGCGCGCAGCAGGCTGGCTGG + Exonic
1180161512 21:46000527-46000549 TGTGCGGGGACCCGGGGGCCTGG - Intronic
1181394710 22:22612866-22612888 TGTGCTGGGAGCAGGAGGTCAGG - Intergenic
1181463920 22:23100672-23100694 TGTGCTCTGAGCAGAGGGCCTGG + Intronic
1182473318 22:30561730-30561752 TGTGGGCTGAGCCTGCGGCCAGG + Intronic
1182623599 22:31630778-31630800 AGTGAGCGGAGCCGGCGCCCCGG - Intronic
1183074795 22:35420007-35420029 TGTGCGGTGAGCAGGCGGGCAGG + Exonic
1183674567 22:39292243-39292265 TGTGCGGGGAGCGGGCGGGGCGG - Intergenic
1184472240 22:44702446-44702468 TGGGCGCGGCGCAGGCGGCCCGG + Intronic
1185400008 22:50610799-50610821 TGCGCCTGGAGCAGACGGCCAGG - Exonic
951611342 3:24495140-24495162 GCGGCGCGGAGCAGGCGCCCCGG - Intronic
965728547 3:171745909-171745931 TGTGAGTGCAGCAGGCAGCCTGG - Intronic
966182286 3:177197839-177197861 TGGGGGCGGGGCGGGCGGCCCGG - Intergenic
967274977 3:187765554-187765576 TGTGAGGGGTGCAGGAGGCCTGG - Intergenic
967875847 3:194268053-194268075 TGTGTGGGGACCAGGGGGCCTGG + Intergenic
967969082 3:194986035-194986057 GGTGGGCGGAGCAGGAGGTCAGG - Intergenic
968448450 4:663986-664008 GGTGCGCGGGGCCGGCGGGCAGG - Intronic
969597799 4:8158777-8158799 CGGGCGCGGAGCCGGCGGGCGGG - Intronic
970565378 4:17327141-17327163 GGTGGGCGGAGCAGGAGGCGTGG - Intergenic
975473198 4:74793947-74793969 TGTGCGCACAGCAGAGGGCCTGG - Intronic
979624078 4:122826946-122826968 TGCGCGGCGAGCCGGCGGCCCGG - Exonic
985778359 5:1857064-1857086 TGTGCGGGGAGCCAGCGGCCCGG - Intergenic
986253697 5:6083777-6083799 TGTGGGAGGGGCAGGAGGCCAGG - Intergenic
999470250 5:151848848-151848870 TGGGCGCTGAGCAGGCGGGCGGG - Intronic
1001332072 5:170769466-170769488 TGTGGGCAGAGCAGTCAGCCTGG - Intronic
1002700966 5:181124569-181124591 GGTGGGAGGAGCAGGTGGCCAGG + Exonic
1002705127 5:181155656-181155678 GGTGGGAGGAGCAGGTGGCCAGG - Exonic
1002925633 6:1604540-1604562 AGTGCGCGGTGCGGGCGCCCAGG + Intergenic
1003514988 6:6810386-6810408 TGTGCTAGGAGCAGGCAGCCTGG - Intergenic
1003995547 6:11537332-11537354 TGCGCGCGGTGCGGGCGGCGTGG - Intergenic
1006351087 6:33521683-33521705 TGAGCGCGGCGCGGGCGGCCCGG + Intergenic
1011765037 6:90611123-90611145 CGCGCGCGGAGGAGGCGGCCGGG + Intergenic
1014098210 6:117482690-117482712 CGTCCGCAGAGGAGGCGGCCCGG + Exonic
1016329848 6:142945056-142945078 GGCGCGCGGCGCAGGCGGCCGGG - Intronic
1018926435 6:168209931-168209953 TCTGTGGGGAGCAGGAGGCCGGG - Intergenic
1019499036 7:1355285-1355307 TGGGCGCGGTGCAGGCGGGAGGG + Intergenic
1020096860 7:5374331-5374353 TGCCCGCGGGGCCGGCGGCCAGG + Exonic
1021717642 7:23474068-23474090 TATGCGCGGAGCGTGTGGCCGGG + Intergenic
1021924344 7:25520364-25520386 TCTGCCAGGAGCAGCCGGCCTGG - Intergenic
1024043875 7:45574599-45574621 GGGGCGCCGAGCGGGCGGCCGGG + Exonic
1024998646 7:55295457-55295479 GGTGGGCGGATCAGGAGGCCAGG + Intergenic
1029270419 7:99374228-99374250 TGGGCGGGGAGCAGGCGGTCCGG - Intronic
1029537173 7:101163611-101163633 TGTTCGCGGAGGAGGAGGACGGG - Exonic
1034717545 7:153257156-153257178 TGTGAGTGGAGCAGGAGACCTGG + Intergenic
1034970177 7:155413780-155413802 TGTGCTAGGAGCTGGCGGTCAGG + Intergenic
1036446296 8:8824216-8824238 TCTGCGGGGAGCAGGATGCCTGG + Intronic
1040386432 8:46917848-46917870 GGCGCGGGGAGCAGGAGGCCGGG + Intergenic
1044685664 8:94823433-94823455 TGAGCGCGGAGGCGGCGGACCGG + Exonic
1046654051 8:116874203-116874225 TACCCGCGGAGTAGGCGGCCCGG + Intronic
1049223022 8:141436507-141436529 TGGGCGCTGAGCAGGTGGGCTGG - Intergenic
1049235017 8:141508087-141508109 GGGTCGCGGAGCAGGCGGCGGGG - Intergenic
1055501441 9:76906168-76906190 GGTGCCCAGAGCCGGCGGCCGGG - Intergenic
1057189674 9:93079663-93079685 TGTGGGAGCAGCAGGTGGCCCGG - Intronic
1057199727 9:93133743-93133765 AGTGCGCGGAGGAGCCGGCACGG + Intronic
1058984019 9:110195330-110195352 GGTGGGCGGATCAGGAGGCCAGG + Intronic
1060806260 9:126579174-126579196 GGGGCTGGGAGCAGGCGGCCCGG - Intergenic
1061208456 9:129177419-129177441 GGGGCGCGGAGCAGGCGGCCGGG + Exonic
1061986365 9:134132381-134132403 TGTCCTCGAAGCAGGCAGCCCGG - Intergenic
1062497395 9:136838211-136838233 TGTGGGCAGAGCAGGTGGCCAGG - Intronic
1062596812 9:137303280-137303302 CAGGCGCGGAGCAGGAGGCCAGG + Intergenic
1062618958 9:137411043-137411065 TGTGCGCTGAGCAGGTGTCCAGG + Intronic
1062623859 9:137434319-137434341 TGGGATCGGGGCAGGCGGCCGGG - Exonic
1185563315 X:1077331-1077353 TGGGCGCGGAGCACGAGGGCAGG + Intergenic
1189316243 X:40058803-40058825 AGTGCTCGGGGCAGGTGGCCTGG - Intronic
1189337248 X:40177237-40177259 TGTGCGGGGAGAAGGCGGGGGGG - Intronic
1191055215 X:56233406-56233428 TGTGGGGGGAGCAGGGGGACTGG - Intronic
1193823597 X:86195533-86195555 TCTGCACGGAGCAGGCATCCTGG + Intronic
1196763624 X:119223160-119223182 AGCGGGCGCAGCAGGCGGCCAGG + Intergenic
1196925551 X:120630166-120630188 TGTGCGCGCAGCGGGCGCGCCGG - Intergenic
1197446039 X:126552886-126552908 AGTGGGAGGAGCAGGCGGTCGGG + Intergenic
1200835378 Y:7726881-7726903 TGGGAGCTGAGCAGGCAGCCGGG + Intergenic
1201302891 Y:12525501-12525523 TGTGTGGGGACCAGGCAGCCAGG + Intergenic
1202046119 Y:20738581-20738603 TGTGCCAGGAGCAGACTGCCCGG - Intergenic