ID: 1130370852

View in Genome Browser
Species Human (GRCh38)
Location 15:83284476-83284498
Sequence TTCTCTGTGCGCGGAGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370852_1130370863 13 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370852_1130370856 -5 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370852_1130370857 -4 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370852_1130370855 -8 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370852 Original CRISPR TTCTCTGTGCGCGGAGCAGG CGG (reversed) Intronic
900379899 1:2378535-2378557 TGCTCACTGCACGGAGCAGGTGG - Intronic
902198271 1:14814554-14814576 TTGTCTGTGCTCAGAGCACGGGG - Intronic
902759546 1:18572184-18572206 TCCTCTGTCCCCAGAGCAGGTGG - Intergenic
904894322 1:33802723-33802745 CTCCCTTTGCGAGGAGCAGGGGG - Intronic
906202600 1:43969877-43969899 TTCTCTGTGCGGGGCGGTGGCGG + Intergenic
906586348 1:46982760-46982782 TTCTCAGTGCTCTGAGCATGTGG + Intergenic
909838924 1:80293316-80293338 TTCTCTCTGAGTGGAGAAGGTGG + Intergenic
913958791 1:143323878-143323900 TGCTCTGTGCCAGGAGGAGGAGG - Intergenic
914053108 1:144149258-144149280 TGCTCTGTGCCAGGAGGAGGAGG - Intergenic
914126089 1:144817283-144817305 TGCTCTGTGCCAGGAGGAGGAGG + Intergenic
920632825 1:207669335-207669357 TGCTCTGGGCGCGGAGCACAAGG + Intronic
921090140 1:211834432-211834454 TTATCTGTTTGGGGAGCAGGGGG - Intergenic
921181619 1:212636174-212636196 TTCTGTGTGCCTGGGGCAGGGGG + Intergenic
922240363 1:223751572-223751594 CTCTCTGTCCACGGAGCAGAAGG - Intronic
922919559 1:229290529-229290551 TTATGTGTGGGTGGAGCAGGTGG - Intronic
923885780 1:238153770-238153792 CTCTCTGTGCACAGAGTAGGCGG + Intergenic
924177016 1:241401358-241401380 TCCTCCGTGGGTGGAGCAGGAGG + Intergenic
1063362045 10:5467022-5467044 CTCTCTGTGCACCGGGCAGGAGG + Intergenic
1064252024 10:13713217-13713239 TTATCTGTGCAAGGAGGAGGTGG - Intronic
1064729641 10:18317107-18317129 TTTTCTGTGTGGGGGGCAGGGGG - Intronic
1065249382 10:23795354-23795376 TTTTCTGTGCACGGGGCAAGTGG - Intronic
1070258112 10:74827300-74827322 TTGTCTGGGCGCAGAGTAGGTGG + Intronic
1072686789 10:97542375-97542397 TTCTTTGTGCCCAGAGCAGCTGG + Intronic
1076055688 10:127370401-127370423 TTCTGTGGGAGCGCAGCAGGAGG - Intronic
1077014887 11:395062-395084 TTCTCTGTGGGAACAGCAGGTGG + Intronic
1077459454 11:2701332-2701354 TTGCCTGTGGGCTGAGCAGGAGG - Intronic
1078106587 11:8361715-8361737 TTATCTGTACGTGGAGCTGGTGG + Intergenic
1078525869 11:12100824-12100846 CTCACTGTGCGCAGAGGAGGGGG - Intronic
1083079643 11:60077320-60077342 TGCTCTGTGTCCGGAGTAGGTGG - Intergenic
1084558187 11:69887520-69887542 CCCTCTGTGCCCAGAGCAGGAGG - Intergenic
1085450544 11:76629585-76629607 TGCTGTGTGCGGGGAGCATGGGG + Intergenic
1086215523 11:84374896-84374918 TTCTCTGTGATTGGAGTAGGGGG - Intronic
1090639825 11:128720866-128720888 TTCTCTGTGTGTGGCGGAGGTGG + Intronic
1091807629 12:3367125-3367147 CTTGCTGTGCGCGGTGCAGGAGG + Intergenic
1099500280 12:83405482-83405504 TTCTCTGTGGGTATAGCAGGTGG + Intergenic
1100985369 12:100198291-100198313 CTCTATGTGCTCGAAGCAGGTGG + Intergenic
1103074051 12:117968279-117968301 TTCTCTCTGGGAGGAGGAGGAGG - Intronic
1104010727 12:124928336-124928358 TTTCCTTTGCGCGGAGAAGGGGG - Intergenic
1104983212 12:132583043-132583065 CGCTCTGGGCCCGGAGCAGGAGG - Exonic
1105073742 12:133255961-133255983 TTCTATGTGGCTGGAGCAGGAGG + Intergenic
1106460662 13:29964840-29964862 TTCTCTATGCACTGGGCAGGAGG + Intergenic
1113048451 13:106182615-106182637 TTGTCTGAGTGCTGAGCAGGAGG + Intergenic
1113531444 13:111030347-111030369 TTCTCTGTGCGCTGGGCATCAGG - Intergenic
1114822672 14:26040516-26040538 TACTCTGTGGGCAGAGCAAGTGG + Intergenic
1115116308 14:29884724-29884746 TTCACTGAGCGTGGAGAAGGAGG + Intronic
1115478759 14:33841322-33841344 TTCACTGTGTGTGCAGCAGGAGG - Intergenic
1116399340 14:44486286-44486308 TCCTCTGTGGGGGAAGCAGGAGG - Intergenic
1118753559 14:68822903-68822925 TTCTCTGTGACAGCAGCAGGGGG - Intergenic
1120380468 14:83772232-83772254 TTCTCTGTTCACTGAGCTGGAGG - Intergenic
1127417604 15:58772040-58772062 TCCTCTGTGCAAGGAGGAGGAGG + Exonic
1128082612 15:64865412-64865434 TGCACTGTGCCTGGAGCAGGTGG - Exonic
1129460184 15:75696655-75696677 CTCTATGGGCGCTGAGCAGGAGG - Intronic
1130370852 15:83284476-83284498 TTCTCTGTGCGCGGAGCAGGCGG - Intronic
1132513415 16:354745-354767 ATCACTGTGCTCAGAGCAGGTGG + Intergenic
1132841642 16:1980988-1981010 TTCTCTGTGCGCTGGTCAGACGG - Exonic
1134128169 16:11630480-11630502 TCCTGTGTGCCTGGAGCAGGCGG - Intronic
1136591354 16:31219553-31219575 GTCTCTGGGCCCTGAGCAGGGGG - Intronic
1136909405 16:34134034-34134056 TTCTCTGTGTGTGGGGCAAGAGG + Intergenic
1142189205 16:88709888-88709910 CTCACTGTGCGGGTAGCAGGCGG + Intronic
1142236094 16:88923276-88923298 TCCTCTGTGCGATGAGGAGGGGG - Intronic
1142302144 16:89265090-89265112 CTCTCTGTGCGGGGAGCTGACGG + Intergenic
1145994307 17:29096729-29096751 TTCTCTGGGCCCAGGGCAGGGGG + Intronic
1151420378 17:73993236-73993258 TTCTCTGTGGTGGGGGCAGGGGG - Intergenic
1151679287 17:75615164-75615186 TTCTCTGTGCCTGGGGCTGGAGG + Intergenic
1151784117 17:76266629-76266651 TTCTCTGTGTGCTGGGCTGGTGG - Intronic
1153377388 18:4396044-4396066 TTCCCTGTGCCCGCAGCCGGTGG - Intronic
1153498425 18:5722938-5722960 TTCTTTGTGAGGGGAGCATGGGG - Intergenic
1158560167 18:58506794-58506816 TTCTCTGTGGGGGTGGCAGGGGG + Intronic
1161321031 19:3641650-3641672 TCCTCTGGGCCCGCAGCAGGTGG + Intronic
1163665154 19:18599767-18599789 GTCTCCGTGCACTGAGCAGGTGG + Exonic
1167455778 19:49596226-49596248 TCCTCTGTGCGCTCCGCAGGAGG - Exonic
1168234062 19:55050855-55050877 TTCTCTGTGTGAGAAGGAGGGGG + Intronic
1202692503 1_KI270712v1_random:101681-101703 TGCTCTGTGCCAGGAGGAGGAGG - Intergenic
925251352 2:2441540-2441562 ATCTCTGTGTGGGGAGAAGGAGG + Intergenic
927041415 2:19234409-19234431 TTCTCAGTGCTTGGAGAAGGGGG + Intergenic
930529335 2:52571544-52571566 GTCTCTGTGCTCGGGACAGGGGG - Intergenic
931225062 2:60322322-60322344 TTCCCTGTGGGGGGAGCAGCTGG - Intergenic
932779294 2:74549821-74549843 CTCCCTGTGCCTGGAGCAGGAGG + Intronic
933514692 2:83285755-83285777 TTCTCTGTTCTTGGACCAGGAGG - Intergenic
939002908 2:136756803-136756825 TTCTCTGTGGCAGCAGCAGGAGG - Intergenic
940787873 2:158001567-158001589 TTCTCTGTGCCCCAAGTAGGAGG - Intronic
946195130 2:218028266-218028288 TTCTCTGGGCACCCAGCAGGAGG - Intergenic
1168930755 20:1621610-1621632 TTCTGTGAGTGTGGAGCAGGAGG - Intergenic
1170604758 20:17867473-17867495 TTCTCTGTCCGCAGAGCTTGTGG - Intergenic
1171322639 20:24259847-24259869 TTCTGTGTGAGGGGATCAGGAGG + Intergenic
1171428502 20:25063821-25063843 TGCTCTGAGGGCGGTGCAGGAGG + Intergenic
1175295002 20:57902349-57902371 GTCTCTGTTGGAGGAGCAGGAGG - Intergenic
1175507350 20:59495330-59495352 TGCTGTGTGGGTGGAGCAGGAGG - Intergenic
1177075967 21:16573793-16573815 TAGTCTGTGGGCTGAGCAGGAGG - Intergenic
1179881484 21:44294978-44295000 CTCTCTGACCCCGGAGCAGGAGG - Intronic
1183036418 22:35144161-35144183 TTCTCTGTGTGAAGAGCATGTGG + Intergenic
1183074793 22:35420002-35420024 ATCACTGTGCGGTGAGCAGGCGG + Exonic
1184661302 22:45966840-45966862 TTCTCTGTGCAAGCAGCCGGTGG - Intronic
959257282 3:104031371-104031393 TTCTCTGTGCTCTGAGTATGGGG - Intergenic
961202259 3:125054920-125054942 TTCTCTCTGCGTGGGACAGGCGG + Intronic
968662749 4:1805540-1805562 TCGTCTGTGCACGGAGCGGGGGG - Exonic
969225961 4:5798535-5798557 TTCTCTGTGAGAGGAGCACTTGG + Intronic
985636006 5:1036238-1036260 TTCTCTGTGCTCCAAGCAGGAGG + Exonic
992473222 5:77077650-77077672 CCGTCTGTGCGGGGAGCAGGTGG - Exonic
999470253 5:151848853-151848875 TGTTCTGGGCGCTGAGCAGGCGG - Intronic
1001045511 5:168368532-168368554 TTCTCTGGGCACAGTGCAGGTGG + Intronic
1002447090 5:179296322-179296344 CTGTCTGTGCTCGGAGGAGGGGG + Intronic
1002616345 5:180458851-180458873 CTCTCTGTGCGGTGAGCAGTGGG + Intergenic
1007322851 6:41039741-41039763 TTCTCTGTGTGGGGAGCGGGTGG - Intronic
1012890194 6:104888315-104888337 TTCTCTGTGTGATGAGCAGCAGG + Intergenic
1013524559 6:110962227-110962249 TTTTCTATGCTTGGAGCAGGAGG + Intronic
1016683650 6:146857610-146857632 TTCTCTGTGTGTCCAGCAGGGGG + Intergenic
1018053584 6:160032652-160032674 TTCTCTGAGCGGCGAGCAGCAGG + Exonic
1019001498 6:168757079-168757101 TCCTATGTGCCTGGAGCAGGAGG + Intergenic
1019079380 6:169419813-169419835 GTCCCTGTGCGGGGAGGAGGAGG + Intergenic
1020007691 7:4791162-4791184 CTCGCTGTGCGTGGAGCTGGTGG - Exonic
1023128806 7:36981866-36981888 TTCTCTGTTACCAGAGCAGGTGG + Intronic
1026880623 7:73904737-73904759 TTCCCTGGACACGGAGCAGGTGG + Intergenic
1031597325 7:123662919-123662941 TTCTCTGGGAGTGGAGGAGGGGG - Exonic
1035770574 8:2143517-2143539 TTCTCTTGGGGCGGAGCAGAGGG + Intronic
1040585339 8:48735408-48735430 TTCTCGGTGCGCGGTGCCGCCGG + Intergenic
1042514294 8:69643708-69643730 TTCCCTGTGTGTGAAGCAGGAGG + Intronic
1045310492 8:100997507-100997529 CTCTCTGTGCGGTTAGCAGGAGG - Intergenic
1048531315 8:135253017-135253039 CTCTCTGTGTGGGCAGCAGGGGG - Intergenic
1049440309 8:142606561-142606583 ATCTCTCTGGGCGGAGCTGGGGG - Intergenic
1051136114 9:13923509-13923531 TTTTCTGTGCGGTGAGCAGCAGG - Intergenic
1053173717 9:35908012-35908034 TTCTCTGTGAGGGCTGCAGGAGG + Intergenic
1053282706 9:36831321-36831343 TCCTCTGTGCTGGGTGCAGGAGG - Intergenic
1053467012 9:38316179-38316201 TACTTTGTGAGCTGAGCAGGTGG + Intergenic
1056546614 9:87619063-87619085 TTCTCTGTGGGTGGAGCATCAGG - Intronic
1056929168 9:90860592-90860614 TTCTCTGTGGCCTCAGCAGGTGG - Intronic
1057546014 9:96021061-96021083 CTCCCTGTGCCCGGCGCAGGCGG - Intergenic
1061988924 9:134147249-134147271 TTCTCTGGGCGTGCAGCAGCAGG + Intronic
1062462040 9:136666160-136666182 TTCGCGGGGGGCGGAGCAGGCGG - Intronic
1187030939 X:15487658-15487680 TCCTCTGTGCTCCCAGCAGGAGG - Intronic
1189279881 X:39813584-39813606 TTCTTTGTGCCAGGAACAGGTGG - Intergenic
1192543879 X:71996891-71996913 TTCCCTGAGGGCTGAGCAGGAGG + Intergenic
1194223513 X:91226738-91226760 TTCTCCGTGCTGGGGGCAGGGGG + Intergenic
1196794698 X:119492749-119492771 TTGTCTGTGAGGGGAGGAGGAGG + Intergenic
1199275366 X:145935968-145935990 TTCACTCTGGGCGGAGGAGGAGG + Intergenic
1200559980 Y:4690120-4690142 TTCTCCGTGCTGGGGGCAGGGGG + Intergenic