ID: 1130370852

View in Genome Browser
Species Human (GRCh38)
Location 15:83284476-83284498
Sequence TTCTCTGTGCGCGGAGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370852_1130370863 13 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370852_1130370857 -4 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370852_1130370855 -8 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370852_1130370856 -5 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370852 Original CRISPR TTCTCTGTGCGCGGAGCAGG CGG (reversed) Intronic