ID: 1130370853

View in Genome Browser
Species Human (GRCh38)
Location 15:83284479-83284501
Sequence GGATTCTCTGTGCGCGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370853_1130370856 -8 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370853_1130370866 30 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370866 15:83284532-83284554 CGGCCATCCTGCGACCGCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 45
1130370853_1130370863 10 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370853_1130370857 -7 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370853 Original CRISPR GGATTCTCTGTGCGCGGAGC AGG (reversed) Intronic