ID: 1130370853

View in Genome Browser
Species Human (GRCh38)
Location 15:83284479-83284501
Sequence GGATTCTCTGTGCGCGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370853_1130370856 -8 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370853_1130370863 10 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370853_1130370866 30 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370866 15:83284532-83284554 CGGCCATCCTGCGACCGCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 45
1130370853_1130370857 -7 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370853 Original CRISPR GGATTCTCTGTGCGCGGAGC AGG (reversed) Intronic
900314391 1:2049901-2049923 GGATTCGCTGGGGGCGGAGTGGG + Intergenic
900319953 1:2078132-2078154 GGCTTCCCTGTGCCCCGAGCTGG + Intronic
900351674 1:2238017-2238039 GGCTTCTCTGTGCCAGGCGCTGG + Intronic
900726407 1:4219163-4219185 GGATGCTCTGTGCCCCGGGCTGG - Intergenic
901826121 1:11862675-11862697 GGATGCTCTGTGAGCACAGCAGG + Intergenic
903856842 1:26342880-26342902 GGAATCTCTGTGCCCACAGCTGG - Exonic
905114136 1:35622638-35622660 GGGTTCTCTGGGCTCGCAGCAGG + Intronic
908132708 1:61090806-61090828 TGCTTCTCTGTGCGCGCAACAGG + Intronic
910874106 1:91861572-91861594 AGATTGTCTGTGCTCTGAGCAGG - Exonic
911230045 1:95351489-95351511 GGATTCTCTGTGGGTGGGTCTGG + Intergenic
913504997 1:119508756-119508778 GGATTCTCTGTGGGCAGGGCAGG - Intronic
913508369 1:119540032-119540054 GGCTTCTCTGTGCACAGGGCAGG - Intergenic
914355934 1:146884663-146884685 GGATTGACTGTGGGAGGAGCAGG - Intergenic
921155036 1:212432847-212432869 GGAGGCTCTGGGCGCGGGGCGGG + Intergenic
1062883142 10:994962-994984 GGAGTATCTGTGCGGGGAGAGGG + Intronic
1064331851 10:14401599-14401621 GGATTCTCTGAGCATGGAGAGGG - Intronic
1065813134 10:29460816-29460838 GGATTGTCTGAGCCTGGAGCTGG + Intronic
1075297108 10:121287297-121287319 GGATTCTATGTGCATTGAGCAGG + Intergenic
1077485661 11:2837384-2837406 GGAGGCTGTGAGCGCGGAGCGGG - Intronic
1080386670 11:31814638-31814660 GGATCCCTTGTCCGCGGAGCTGG + Intronic
1083079644 11:60077323-60077345 GGATGCTCTGTGTCCGGAGTAGG - Intergenic
1083730294 11:64649106-64649128 GGCTTCTCTGGGAGGGGAGCAGG - Intronic
1084556781 11:69880313-69880335 GGATTCTGTGAGCGGGGGGCAGG + Intergenic
1086116360 11:83255138-83255160 GGAGCCTCTGTGTTCGGAGCTGG + Intronic
1089518903 11:119051000-119051022 GGATACCCTGTGTGCAGAGCAGG - Intronic
1092650992 12:10634640-10634662 GCATTCTCTGTGGGCCTAGCAGG - Exonic
1102681403 12:114692900-114692922 GGAATCTTCGTGCGCGAAGCCGG + Intergenic
1105019147 12:132804902-132804924 GGATTCGCTGAGCTCGGAGGTGG - Exonic
1130370853 15:83284479-83284501 GGATTCTCTGTGCGCGGAGCAGG - Intronic
1130380909 15:83371784-83371806 GGATTCCCTGTGCCCTGAACAGG + Intergenic
1131096890 15:89661590-89661612 GGTTCCTCTGTGCGCAGAGAGGG - Intergenic
1132368652 15:101277381-101277403 GGAGTCTCTGTCCGCGCGGCCGG - Exonic
1138384191 16:56625346-56625368 GGATCCGCTGAGTGCGGAGCGGG - Intergenic
1139365006 16:66427546-66427568 GGAGCCTCGGTGCGCGGGGCGGG + Intronic
1139481670 16:67234172-67234194 GGCTTCGCTGGGCCCGGAGCAGG + Exonic
1139914988 16:70422434-70422456 GGGTGCTCTGGGCGCTGAGCAGG + Intronic
1141644063 16:85358072-85358094 GGCTGCTCTGTGCGGGGAGATGG + Intronic
1142376218 16:89708381-89708403 GGGGTCTCTGTGCGAAGAGCAGG - Intronic
1152742350 17:82023811-82023833 GGAGACGCTGTGCACGGAGCTGG + Exonic
1163325522 19:16600676-16600698 GGATTCTCTTTGGGAGGAGCAGG - Intronic
1163762877 19:19146642-19146664 GGCTTCTCTGTGCGGAGAGAGGG + Exonic
1166126373 19:40717367-40717389 GGACTCTCTGTCCCCGGCGCAGG - Exonic
1167954887 19:53056841-53056863 GGCTTCTCTGGGAGGGGAGCGGG - Intergenic
929612154 2:43278979-43279001 GGATTCTCTGTGCTTGGGGCTGG - Intronic
948898901 2:240946158-240946180 GGATGCTCTGTCTGAGGAGCGGG + Intronic
948975339 2:241460233-241460255 GAATTCTCTGGGGGCAGAGCTGG - Intronic
1168986618 20:2054462-2054484 GGCTTCTCTGTTCCTGGAGCTGG + Intergenic
1169889951 20:10441508-10441530 GGATTTTCTGTGGGCACAGCAGG + Intronic
1171041463 20:21767787-21767809 GGCGCCGCTGTGCGCGGAGCTGG - Intergenic
1182396928 22:30042911-30042933 CCATTCTCTGTGTGCAGAGCTGG + Intergenic
1182546300 22:31078605-31078627 GGATAGGCTGTGGGCGGAGCAGG - Intronic
1182927433 22:34138672-34138694 GGGTTCTCTGTTTGCTGAGCAGG - Intergenic
1184119761 22:42442125-42442147 GGATTCTCAGGGCGAGGAGGAGG + Intergenic
1185111134 22:48900943-48900965 GGATTCTGTCGGCTCGGAGCTGG - Intergenic
950160113 3:10754127-10754149 GGGTTCTCTGTGCCCGAGGCTGG - Intergenic
950284518 3:11734126-11734148 GGGTTCTCTTTGCACAGAGCCGG - Intergenic
955948043 3:64214073-64214095 TGGTTCTCTGTGCATGGAGCTGG - Intronic
960952588 3:123009222-123009244 GGGTTCTCAGTGCAGGGAGCGGG + Intronic
968662752 4:1805543-1805565 GCATCGTCTGTGCACGGAGCGGG - Exonic
975295136 4:72726103-72726125 GGATTCTGTGTGCTTGGAGGAGG + Intergenic
998658159 5:144205422-144205444 GGCTTCTCTGGCGGCGGAGCTGG - Exonic
1005040110 6:21593983-21594005 GGACTCTCTGTGGGCGGAATCGG - Exonic
1005349383 6:24919150-24919172 GGATTCTATGTGAGCAGAGAAGG - Intronic
1006806900 6:36794457-36794479 GGACTCTCTGTCCCCGGATCAGG + Intronic
1007313942 6:40969285-40969307 GGATTCCCTGTGGGAGGATCAGG - Intergenic
1007322852 6:41039744-41039766 GTCTTCTCTGTGTGGGGAGCGGG - Intronic
1018471655 6:164102525-164102547 TGATTCTCTGTGTAAGGAGCTGG + Intergenic
1023366392 7:39468270-39468292 TGCTTCTCCGTGCCCGGAGCAGG + Intronic
1035221033 7:157406671-157406693 GGCTTCTCTGAGCCCGCAGCCGG + Intronic
1038034037 8:23671977-23671999 TGCTTCTCTGTGTGCGAAGCTGG + Intergenic
1042367395 8:67952617-67952639 GCATTGTCTGTGCGGGGACCCGG + Intronic
1053173716 9:35908009-35908031 GGATTCTCTGTGAGGGCTGCAGG + Intergenic
1061015665 9:127979862-127979884 GGATTCTGTGTGCCTGGGGCAGG - Intronic
1061886659 9:133594449-133594471 GGAATCTCAGTACGCAGAGCTGG - Intergenic
1062618955 9:137411035-137411057 GGCTGCCCTGTGCGCTGAGCAGG + Intronic
1191791372 X:64975834-64975856 GGAATCTCAGCGGGCGGAGCTGG - Intronic
1202119779 Y:21510316-21510338 GGATGGTCTGTGCACAGAGCAGG - Intergenic
1202122230 Y:21533857-21533879 GGATGGTCTGTGCACAGAGCAGG - Intronic
1202156775 Y:21895526-21895548 GGATGGTCTGTGCACAGAGCAGG + Intronic
1202159223 Y:21919067-21919089 GGATGGTCTGTGCACAGAGCAGG + Intergenic
1202185672 Y:22183982-22184004 GGATGGTCTGTGCACAGAGCAGG + Intergenic
1202205688 Y:22402414-22402436 GGATGGTCTGTGCACAGAGCAGG - Intronic