ID: 1130370855

View in Genome Browser
Species Human (GRCh38)
Location 15:83284491-83284513
Sequence ACAGAGAATCCCCGCGCCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370851_1130370855 -3 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370852_1130370855 -8 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370849_1130370855 8 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370848_1130370855 9 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370843_1130370855 24 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370850_1130370855 -2 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370846_1130370855 15 Left 1130370846 15:83284453-83284475 CCGGAGCCCAGCGGCGTCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39
1130370842_1130370855 25 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG 0: 1
1: 0
2: 0
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370855 Original CRISPR ACAGAGAATCCCCGCGCCCG CGG Intronic
900218292 1:1494100-1494122 ACAGAGAGCTCCCGGGCCCGGGG + Intronic
921218977 1:212959964-212959986 ACAGAGAATCTCAGCCCACGTGG - Intronic
1075157316 10:119989056-119989078 ACAGGGAATCCCCCAGCCCTGGG - Intergenic
1084480324 11:69416135-69416157 ACACAGGATCCCTGCACCCGTGG + Intergenic
1089130370 11:116207727-116207749 GCAGAGAATGCCCGAGCCCGGGG + Intergenic
1107082939 13:36394398-36394420 ACAGAAAATCCCCATGCCCTTGG - Intergenic
1113808282 13:113122583-113122605 ACAGAAAGTCCCCACACCCGCGG + Intergenic
1113824351 13:113239572-113239594 GCAGGGAATGCCCACGCCCGCGG - Intronic
1122865703 14:104603127-104603149 AATGAGAATCCCAGCGCCTGTGG - Intronic
1125677882 15:41512156-41512178 ACAGCGACTCCCCGAGACCGAGG + Exonic
1130370855 15:83284491-83284513 ACAGAGAATCCCCGCGCCCGCGG + Intronic
1133279865 16:4659218-4659240 ACAGAGACTCCACCCACCCGAGG - Intronic
1152790116 17:82274109-82274131 ACAGAGCAGGCCCGCGCCCTGGG + Intergenic
1160403449 18:78628487-78628509 AAAGAGAATCACAGCCCCCGGGG + Intergenic
1160419428 18:78734005-78734027 CCAGAGAATCCCCGAGGCCTTGG + Intergenic
926089715 2:10042413-10042435 AGAGAGAATCCCGGCACCCCGGG - Intergenic
938822672 2:134975405-134975427 GCAGAGAATCCCCAGGCCCCAGG + Intronic
947024835 2:225725774-225725796 ACAGAGAATCCCAGCTCACCAGG + Intergenic
948655733 2:239475754-239475776 ACAGAGAAGCCCCCCACCCTTGG - Intergenic
1168733033 20:103777-103799 ACAGATCATCCCCGTGCCCCAGG + Intergenic
1173151775 20:40572230-40572252 ACAGAAAATCCAAGCGCCAGGGG + Intergenic
1175760602 20:61560182-61560204 ACAGTGAATCCCCCCACCTGCGG + Intronic
1176107295 20:63395517-63395539 TCAGAGAATCCCCAAGCCTGGGG + Intergenic
951348233 3:21572585-21572607 ACAGAGTTTCCCCGGGCCCTTGG + Intronic
954623142 3:52007004-52007026 ACAGAGCATCTCAGCGCCAGAGG - Intergenic
955339426 3:58113585-58113607 ACACAGAATCCCTTCGCCCAGGG - Intronic
968478816 4:825188-825210 ACAGAGCACCCCCGCCCCGGGGG + Intronic
968552166 4:1229350-1229372 ACAGAGCATCTCTGCACCCGTGG - Intronic
968703044 4:2065683-2065705 ACAGAGAAGCCCTGCGTCCAAGG + Exonic
968891794 4:3373298-3373320 ACAGAGAGTCCCAGCCCCTGCGG + Intronic
978503497 4:109433666-109433688 ACCCAGGATCCCCGCGCCCGCGG + Intergenic
996312118 5:122118511-122118533 ACAGAGAGTCACCGGGCCTGGGG - Intergenic
1000478623 5:161744066-161744088 ACAGTGAATCCTCGGGCCCAGGG + Intergenic
1012939520 6:105402679-105402701 GCAGAGGAGCCCCGCGCCCCCGG + Intronic
1017768536 6:157626792-157626814 ACAGAGAATACCCGGGGCCGGGG - Intronic
1018400366 6:163414769-163414791 AGAGAGACCCCCCGAGCCCGCGG + Exonic
1019688394 7:2395403-2395425 ACAGAAAATCCCCACGACAGTGG + Intergenic
1032792105 7:135250000-135250022 ACAGAGAACTCCCATGCCCGAGG + Intronic
1034839320 7:154381044-154381066 GCAGAGAAGCCCCACGCCCAGGG - Intronic
1049347438 8:142146357-142146379 ACAGAGAAACCCAGCAGCCGGGG + Intergenic
1057678535 9:97154508-97154530 ACAGACAAACCCCGTGCCTGAGG + Intergenic
1061675095 9:132211126-132211148 ACAGAGAAGCCCTGAGCCCAGGG - Intronic
1203759585 EBV:5177-5199 ACAGATAATCCACCCGCCCCTGG + Intergenic