ID: 1130370856

View in Genome Browser
Species Human (GRCh38)
Location 15:83284494-83284516
Sequence GAGAATCCCCGCGCCCGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 38}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370842_1130370856 28 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370850_1130370856 1 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370851_1130370856 0 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370846_1130370856 18 Left 1130370846 15:83284453-83284475 CCGGAGCCCAGCGGCGTCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370852_1130370856 -5 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370853_1130370856 -8 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370848_1130370856 12 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370843_1130370856 27 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38
1130370849_1130370856 11 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG 0: 1
1: 0
2: 1
3: 3
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370856 Original CRISPR GAGAATCCCCGCGCCCGCGG AGG Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
908353813 1:63312288-63312310 GAGAATCACCGGGACCCCGGAGG - Intergenic
1103519624 12:121529605-121529627 GAGAATCCCCAGGCCTGGGGAGG + Intronic
1103943921 12:124516056-124516078 GAGAACCCCCCCGCCTTCGGAGG + Intronic
1104031255 12:125066789-125066811 GGGAGTCCCTGCGCCAGCGGAGG - Intronic
1116862173 14:50003470-50003492 GGGCGTCCCCGCGCCCCCGGGGG - Intronic
1122658011 14:103274542-103274564 GAGAATCCCCGCGGGAGCGTGGG - Intergenic
1124656935 15:31516408-31516430 GAGGATCCCAGCTCCAGCGGGGG + Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1135003854 16:18801322-18801344 GAGAAGGGCCGGGCCCGCGGCGG + Intronic
1141582830 16:85011809-85011831 GTGTGTACCCGCGCCCGCGGCGG + Intergenic
1150225606 17:63523103-63523125 AAGAAGCCGCGCGCCGGCGGCGG - Intergenic
1151866461 17:76806387-76806409 GAGCCTCCCCGCCCCCGCCGTGG + Intergenic
1152132235 17:78484569-78484591 GAGGATCCCCCCCTCCGCGGGGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1152745615 17:82037335-82037357 GAGAAGCGCAGCGCCCGCGAGGG + Intronic
1153596382 18:6729643-6729665 GCGAATTCGCGCGCCCGGGGCGG + Intergenic
1160430734 18:78810892-78810914 CAGAATCGCCGAGCCCCCGGCGG + Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
928186661 2:29116009-29116031 GAGAGTCCCCGCACGCGCAGTGG + Intronic
932281818 2:70499391-70499413 GAGTATCCCAGGGCCCGCAGTGG + Intronic
935692620 2:105744889-105744911 GACGATCCCCGCGGCAGCGGCGG - Exonic
937294207 2:120799915-120799937 GAGCATCCCCGCCCCTGAGGGGG - Intronic
948304261 2:236935097-236935119 GAGAATCCCAGAGCCCGAGAGGG + Intergenic
1171349047 20:24488854-24488876 GAGCATCCCCGGGCGCTCGGAGG + Intronic
1172326815 20:34042221-34042243 GACGATCCCCGCTCCCGCCGAGG + Intronic
1176680823 21:9818405-9818427 GAGCATCGCGGCGCGCGCGGCGG - Intergenic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1181269707 22:21652107-21652129 GCGAATCCCCGCGCCAGCGCCGG + Intergenic
952693885 3:36243013-36243035 GAGAATCCCTGTGCCCACAGGGG + Intergenic
956684885 3:71816929-71816951 CAGAATCCCCTCCTCCGCGGGGG + Intergenic
961807873 3:129502250-129502272 GAGAATTCCTGCACCCGTGGTGG + Intronic
978503500 4:109433669-109433691 CAGGATCCCCGCGCCCGCGGCGG + Intergenic
1004905451 6:20233446-20233468 GAGTCTCCCCGCCCCCGCCGTGG + Intergenic
1014109283 6:117602370-117602392 GAGTGTGCCCGCGCGCGCGGGGG - Intronic
1019340116 7:504884-504906 GGGAGCCCACGCGCCCGCGGTGG - Intronic
1022410269 7:30134822-30134844 GAAAATCCGGGCGCCCGCGGGGG + Exonic
1022734528 7:33063250-33063272 CAGAAACCCCGCGGCTGCGGCGG - Intergenic
1185778811 X:2828855-2828877 GAGAGGACCCGCGCCCGCGGGGG + Exonic
1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG + Intergenic