ID: 1130370857

View in Genome Browser
Species Human (GRCh38)
Location 15:83284495-83284517
Sequence AGAATCCCCGCGCCCGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370851_1130370857 1 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370852_1130370857 -4 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370848_1130370857 13 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370853_1130370857 -7 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370849_1130370857 12 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370850_1130370857 2 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370843_1130370857 28 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370846_1130370857 19 Left 1130370846 15:83284453-83284475 CCGGAGCCCAGCGGCGTCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370842_1130370857 29 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370857 Original CRISPR AGAATCCCCGCGCCCGCGGA GGG Intronic