ID: 1130370857

View in Genome Browser
Species Human (GRCh38)
Location 15:83284495-83284517
Sequence AGAATCCCCGCGCCCGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 26}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370851_1130370857 1 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370852_1130370857 -4 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370842_1130370857 29 Left 1130370842 15:83284443-83284465 CCCACGGGAGCCGGAGCCCAGCG 0: 1
1: 0
2: 2
3: 14
4: 144
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370849_1130370857 12 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370853_1130370857 -7 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370848_1130370857 13 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370843_1130370857 28 Left 1130370843 15:83284444-83284466 CCACGGGAGCCGGAGCCCAGCGG 0: 1
1: 1
2: 0
3: 27
4: 247
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370850_1130370857 2 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
1130370846_1130370857 19 Left 1130370846 15:83284453-83284475 CCGGAGCCCAGCGGCGTCCCGGG 0: 1
1: 0
2: 0
3: 19
4: 234
Right 1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370857 Original CRISPR AGAATCCCCGCGCCCGCGGA GGG Intronic
907321576 1:53606083-53606105 AGAATCCCAGCTCCAGGGGATGG + Intronic
914903872 1:151728408-151728430 AGAATCCCTGAGCCCTCTGATGG + Intronic
1073460268 10:103661871-103661893 AAAGTCCCCGCGCCAGCGGCTGG + Intronic
1076717442 10:132373525-132373547 CGAATCCCGGCGCCTGCTGAGGG - Intronic
1104031254 12:125066788-125066810 GGAGTCCCTGCGCCAGCGGAGGG - Intronic
1129313107 15:74725868-74725890 GGAGTCCCCGCGCCCCAGGATGG - Intergenic
1130370857 15:83284495-83284517 AGAATCCCCGCGCCCGCGGAGGG + Intronic
1132585690 16:705071-705093 AGAAGCCGCCCGCCCGGGGAGGG + Intronic
1132807612 16:1782330-1782352 GGAACCCGCGCGCCCGCGGGAGG - Intronic
1143237906 17:5419207-5419229 TGAGTCCCCGCGACCGCGTATGG + Intronic
1145979814 17:29004947-29004969 AGAATCCCCGCGCCCCCTCTAGG - Intronic
1150225605 17:63523102-63523124 AGAAGCCGCGCGCCGGCGGCGGG - Intergenic
1163490899 19:17616724-17616746 AGAGACCCAGCGCCCACGGAGGG + Intronic
1166529357 19:43533487-43533509 GGAAGCCCCGCCCCCGGGGAGGG + Exonic
1173831041 20:46089112-46089134 AGAAGCCCCTCGCCCGCTGGCGG + Intronic
1183607096 22:38872218-38872240 ATACTCCCTGCGCCCGCGGCCGG + Exonic
986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG + Exonic
1002926471 6:1608602-1608624 AGAATCGCCGTGCCGGGGGAGGG + Intergenic
1006806701 6:36793720-36793742 AGCATCCCCGGGCCCGCCGGAGG + Intronic
1011127070 6:84019365-84019387 AGAATCCCCGTGCCCGCCTGAGG - Intergenic
1020270290 7:6590577-6590599 AGGATCCCCGCGCTCGCGCTCGG + Intronic
1036398210 8:8386417-8386439 AGAAGCCACCCGCCCGCGGCCGG - Exonic
1037803870 8:22049049-22049071 AGAAAACCCGAGCCCCCGGAGGG + Intronic
1039864615 8:41490381-41490403 ACAATCCCCGCGCGGGCGGAAGG + Intronic
1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG + Intronic
1043873998 8:85464339-85464361 GGAATCCCCGCGTCCGCCGGAGG + Intronic
1056136174 9:83631360-83631382 ATAATCCCAGCGCCCCAGGAGGG + Intronic
1061832585 9:133304958-133304980 CAAATCCCCGAGCCCTCGGAGGG + Intergenic
1062439885 9:136564972-136564994 AGAATCACCGCACACGCAGAAGG - Intergenic