ID: 1130370863

View in Genome Browser
Species Human (GRCh38)
Location 15:83284512-83284534
Sequence GGAGGGCGCCGCGCTTACCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 56}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130370851_1130370863 18 Left 1130370851 15:83284471-83284493 CCGGGCCGCCTGCTCCGCGCACA 0: 1
1: 0
2: 3
3: 23
4: 213
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370849_1130370863 29 Left 1130370849 15:83284460-83284482 CCAGCGGCGTCCCGGGCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 217
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370848_1130370863 30 Left 1130370848 15:83284459-83284481 CCCAGCGGCGTCCCGGGCCGCCT 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370850_1130370863 19 Left 1130370850 15:83284470-83284492 CCCGGGCCGCCTGCTCCGCGCAC 0: 1
1: 0
2: 2
3: 18
4: 281
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370852_1130370863 13 Left 1130370852 15:83284476-83284498 CCGCCTGCTCCGCGCACAGAGAA 0: 1
1: 0
2: 0
3: 2
4: 133
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370853_1130370863 10 Left 1130370853 15:83284479-83284501 CCTGCTCCGCGCACAGAGAATCC 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56
1130370854_1130370863 4 Left 1130370854 15:83284485-83284507 CCGCGCACAGAGAATCCCCGCGC 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG 0: 1
1: 0
2: 0
3: 6
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130370863 Original CRISPR GGAGGGCGCCGCGCTTACCT CGG Exonic
906088074 1:43152927-43152949 GGAAGGAGCCACGCTTACCAAGG - Exonic
907472031 1:54680126-54680148 GGAGGGCGAGGGGCTTATCTGGG - Intronic
908572177 1:65421005-65421027 GGAGGGCGCCGCTCTCGCCGAGG - Intronic
910981250 1:92961560-92961582 GGCGCGCGCCGCGCTCCCCTCGG + Intergenic
912270163 1:108200367-108200389 GGAGCTCGCCGCGCTGGCCTCGG + Intronic
917329732 1:173868622-173868644 GGAGGGGGCCGCCCTTCCCGGGG - Intronic
919910404 1:202107352-202107374 GGAGGGCTCCGAGGTTGCCTTGG - Intergenic
1067450669 10:46380168-46380190 GGAGGGTGCTGCTCTTCCCTGGG + Intronic
1067586574 10:47479583-47479605 GGAGGGTGCTGCTCTTCCCTGGG - Intronic
1068762977 10:60733245-60733267 GGGCGGCGCGGCGCTCACCTGGG + Intronic
1073425274 10:103452138-103452160 GGAGGGCCCCTTCCTTACCTGGG + Exonic
1083272837 11:61580772-61580794 CGCCGGGGCCGCGCTTACCTGGG + Exonic
1083894688 11:65614022-65614044 GGAGGGACCCGAGCTTCCCTCGG + Exonic
1086064516 11:82732390-82732412 GGAGAGCGCCGCGCCTCCGTGGG - Exonic
1088480996 11:110296448-110296470 GGAGGGCGCCGCGCCTTACCCGG + Exonic
1094338554 12:29386286-29386308 GCAGGGGGCCGCGCTAATCTGGG + Intergenic
1103361806 12:120358987-120359009 GGAGGGGGCCACACTCACCTCGG + Exonic
1104745044 12:131205204-131205226 GGAGGGAGCAGCGCTGGCCTGGG + Intergenic
1104789352 12:131472195-131472217 GGAGGGAGCAGCGCTGGCCTGGG - Intergenic
1113505262 13:110812279-110812301 CGAGGGCGCTGGGCTTCCCTGGG - Intergenic
1121437308 14:93928194-93928216 GAAGGGCACCGAGCTGACCTGGG - Exonic
1127588247 15:60397925-60397947 AGGGCGCGCCCCGCTTACCTGGG + Exonic
1128455239 15:67828140-67828162 GGCGGGCGCGGGGCTCACCTTGG - Exonic
1130041011 15:80404934-80404956 GGAGGGCTCCGCGCTGACGGAGG + Intronic
1130370863 15:83284512-83284534 GGAGGGCGCCGCGCTTACCTCGG + Exonic
1133009896 16:2905151-2905173 GGAGGGCGCCGCTCCTCCCTGGG - Intergenic
1138693557 16:58790814-58790836 GCAGGGGGCCGCGCTCATCTGGG + Intergenic
1139544839 16:67645282-67645304 GGAAGGGCCAGCGCTTACCTCGG - Exonic
1142379261 16:89722222-89722244 GGAGGGCGCAGCGCCTGCCCCGG + Intronic
1145915403 17:28571159-28571181 AGAGGGCGGCGCGCTTGCCCCGG + Exonic
1147193005 17:38748178-38748200 GGAGTCCGCTCCGCTTACCTGGG + Exonic
1148462654 17:47847305-47847327 GGAGGGAGCCACGCTGCCCTCGG + Exonic
1151415166 17:73957307-73957329 GGAGGGCCCAGCGCTGAGCTGGG - Intergenic
1152149737 17:78591481-78591503 GGAGTGCCCGGCGCCTACCTGGG + Intergenic
1152571059 17:81121502-81121524 GGAGGGAGCCCCACTTCCCTCGG - Exonic
1157706676 18:49813451-49813473 GGAGGGGGCTGCGCTCACCTCGG + Exonic
1162778861 19:12996340-12996362 GGAGGGCGCAGCGGTTCCCGAGG + Intronic
1163035167 19:14565659-14565681 GGAGGGCGGCAGGCTCACCTGGG - Exonic
1168057028 19:53869617-53869639 GGAGGGGGCGGGGCTTACCCGGG + Intronic
1168586758 19:57600130-57600152 GGAGGACGCAGCGCTCACCTGGG - Exonic
944154016 2:196592754-196592776 CGAGGGCCGCGCGCTCACCTGGG + Intronic
944527846 2:200638270-200638292 GGAGGCCGCCATCCTTACCTTGG + Exonic
946412788 2:219523330-219523352 GGCGGGCGCCGCGCTTCCACGGG - Intronic
1169483331 20:6005755-6005777 GTAGGGCGCCGCACGCACCTTGG + Intergenic
1174277654 20:49415488-49415510 GGAGGGGGCCCCTCTTACCCAGG - Intronic
1176233312 20:64042674-64042696 GGCGGGCGCGACGCTTATCTCGG - Intronic
1179967990 21:44817930-44817952 CGGGGTCGCCGCGCTTACCTTGG + Exonic
1181514357 22:23402647-23402669 GGTGGGCGGGGCGCTCACCTGGG + Intergenic
960702300 3:120450780-120450802 GCCGGGCCCCGCGCTGACCTGGG + Intronic
966947878 3:184790068-184790090 GGAGGCCGCCGTGATTACCGAGG + Intergenic
969053121 4:4386639-4386661 GCAGCGCGCCGCGCTCACCTGGG - Exonic
984024083 4:174522341-174522363 GCTGGGCGCCGGGCTTACCTTGG + Exonic
984928465 4:184826343-184826365 GGAGGGCGCCGCCCGCCCCTCGG - Intronic
1002712660 5:181204571-181204593 GGTGGGGGCTGCGCTCACCTTGG + Exonic
1007777734 6:44233172-44233194 GGGGGGCGCCAAGCTTACTTGGG + Intronic
1019292969 7:259227-259249 GGAGGGCGGCCCGCTCACCCAGG - Intronic
1019828284 7:3301480-3301502 GGGGGGCGCCGCGCCTCCCGCGG + Exonic
1020282204 7:6655375-6655397 GGAGGGTGCCGGGGTGACCTCGG - Exonic
1035122390 7:156579325-156579347 GGAGGAGGCGGCGTTTACCTTGG + Intergenic
1049441687 8:142612555-142612577 GGAGGGGGCCGCGCTGCCCGAGG + Exonic
1187154772 X:16712488-16712510 GGAGGGCGCCGCGCACCCCGAGG - Intronic
1190217501 X:48489582-48489604 GGAGGGCCCCGGGCTGACTTGGG + Intergenic
1199725273 X:150573944-150573966 GGAGGGCGCTGCGGTTAACACGG + Intronic