ID: 1130372747

View in Genome Browser
Species Human (GRCh38)
Location 15:83299975-83299997
Sequence AAGGGTGAACATCAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130372742_1130372747 -3 Left 1130372742 15:83299955-83299977 CCTGCAGGGGAGATTTCACAAAG No data
Right 1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG No data
1130372741_1130372747 -2 Left 1130372741 15:83299954-83299976 CCCTGCAGGGGAGATTTCACAAA No data
Right 1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG No data
1130372738_1130372747 6 Left 1130372738 15:83299946-83299968 CCAGCCCACCCTGCAGGGGAGAT No data
Right 1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG No data
1130372739_1130372747 2 Left 1130372739 15:83299950-83299972 CCCACCCTGCAGGGGAGATTTCA No data
Right 1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG No data
1130372740_1130372747 1 Left 1130372740 15:83299951-83299973 CCACCCTGCAGGGGAGATTTCAC No data
Right 1130372747 15:83299975-83299997 AAGGGTGAACATCAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130372747 Original CRISPR AAGGGTGAACATCAGGAGGA AGG Intergenic
No off target data available for this crispr