ID: 1130373443

View in Genome Browser
Species Human (GRCh38)
Location 15:83306850-83306872
Sequence GGAATAAACCATAGTCTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130373443_1130373453 18 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373453 15:83306891-83306913 AGGGCCTATTAAGGGGATTGAGG No data
1130373443_1130373447 -1 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373447 15:83306872-83306894 CTCCCTTCAGCAGGCACTGAGGG No data
1130373443_1130373452 11 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373452 15:83306884-83306906 GGCACTGAGGGCCTATTAAGGGG No data
1130373443_1130373456 29 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373456 15:83306902-83306924 AGGGGATTGAGGATGGATGAAGG No data
1130373443_1130373455 22 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data
1130373443_1130373450 9 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373450 15:83306882-83306904 CAGGCACTGAGGGCCTATTAAGG No data
1130373443_1130373444 -10 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373444 15:83306863-83306885 GGTTTATTCCTCCCTTCAGCAGG No data
1130373443_1130373451 10 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373451 15:83306883-83306905 AGGCACTGAGGGCCTATTAAGGG No data
1130373443_1130373446 -2 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373446 15:83306871-83306893 CCTCCCTTCAGCAGGCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130373443 Original CRISPR GGAATAAACCATAGTCTTAC TGG (reversed) Intergenic
No off target data available for this crispr