ID: 1130373445

View in Genome Browser
Species Human (GRCh38)
Location 15:83306871-83306893
Sequence CCTCAGTGCCTGCTGAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130373445_1130373456 8 Left 1130373445 15:83306871-83306893 CCTCCCTTCAGCAGGCACTGAGG No data
Right 1130373456 15:83306902-83306924 AGGGGATTGAGGATGGATGAAGG No data
1130373445_1130373452 -10 Left 1130373445 15:83306871-83306893 CCTCCCTTCAGCAGGCACTGAGG No data
Right 1130373452 15:83306884-83306906 GGCACTGAGGGCCTATTAAGGGG No data
1130373445_1130373453 -3 Left 1130373445 15:83306871-83306893 CCTCCCTTCAGCAGGCACTGAGG No data
Right 1130373453 15:83306891-83306913 AGGGCCTATTAAGGGGATTGAGG No data
1130373445_1130373455 1 Left 1130373445 15:83306871-83306893 CCTCCCTTCAGCAGGCACTGAGG No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130373445 Original CRISPR CCTCAGTGCCTGCTGAAGGG AGG (reversed) Intergenic
No off target data available for this crispr