ID: 1130373449

View in Genome Browser
Species Human (GRCh38)
Location 15:83306875-83306897
Sequence AGGCCCTCAGTGCCTGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130373449_1130373455 -3 Left 1130373449 15:83306875-83306897 CCTTCAGCAGGCACTGAGGGCCT No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data
1130373449_1130373457 28 Left 1130373449 15:83306875-83306897 CCTTCAGCAGGCACTGAGGGCCT No data
Right 1130373457 15:83306926-83306948 CACCTAAACGTTGAAAGCCATGG No data
1130373449_1130373456 4 Left 1130373449 15:83306875-83306897 CCTTCAGCAGGCACTGAGGGCCT No data
Right 1130373456 15:83306902-83306924 AGGGGATTGAGGATGGATGAAGG No data
1130373449_1130373453 -7 Left 1130373449 15:83306875-83306897 CCTTCAGCAGGCACTGAGGGCCT No data
Right 1130373453 15:83306891-83306913 AGGGCCTATTAAGGGGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130373449 Original CRISPR AGGCCCTCAGTGCCTGCTGA AGG (reversed) Intergenic
No off target data available for this crispr