ID: 1130373455

View in Genome Browser
Species Human (GRCh38)
Location 15:83306895-83306917
Sequence CCTATTAAGGGGATTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130373448_1130373455 -2 Left 1130373448 15:83306874-83306896 CCCTTCAGCAGGCACTGAGGGCC No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data
1130373449_1130373455 -3 Left 1130373449 15:83306875-83306897 CCTTCAGCAGGCACTGAGGGCCT No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data
1130373443_1130373455 22 Left 1130373443 15:83306850-83306872 CCAGTAAGACTATGGTTTATTCC No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data
1130373445_1130373455 1 Left 1130373445 15:83306871-83306893 CCTCCCTTCAGCAGGCACTGAGG No data
Right 1130373455 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130373455 Original CRISPR CCTATTAAGGGGATTGAGGA TGG Intergenic
No off target data available for this crispr