ID: 1130373457

View in Genome Browser
Species Human (GRCh38)
Location 15:83306926-83306948
Sequence CACCTAAACGTTGAAAGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130373454_1130373457 8 Left 1130373454 15:83306895-83306917 CCTATTAAGGGGATTGAGGATGG No data
Right 1130373457 15:83306926-83306948 CACCTAAACGTTGAAAGCCATGG No data
1130373448_1130373457 29 Left 1130373448 15:83306874-83306896 CCCTTCAGCAGGCACTGAGGGCC No data
Right 1130373457 15:83306926-83306948 CACCTAAACGTTGAAAGCCATGG No data
1130373449_1130373457 28 Left 1130373449 15:83306875-83306897 CCTTCAGCAGGCACTGAGGGCCT No data
Right 1130373457 15:83306926-83306948 CACCTAAACGTTGAAAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130373457 Original CRISPR CACCTAAACGTTGAAAGCCA TGG Intergenic
No off target data available for this crispr