ID: 1130379879

View in Genome Browser
Species Human (GRCh38)
Location 15:83362472-83362494
Sequence TATGAAACAAGCTTATGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130379877_1130379879 27 Left 1130379877 15:83362422-83362444 CCTCATGCATTGGGGGAATATTA No data
Right 1130379879 15:83362472-83362494 TATGAAACAAGCTTATGCTATGG No data
1130379878_1130379879 -1 Left 1130379878 15:83362450-83362472 CCATTAAAATAATTTATATTATT No data
Right 1130379879 15:83362472-83362494 TATGAAACAAGCTTATGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130379879 Original CRISPR TATGAAACAAGCTTATGCTA TGG Intergenic
No off target data available for this crispr