ID: 1130385821

View in Genome Browser
Species Human (GRCh38)
Location 15:83411074-83411096
Sequence GGGTTTAACCACATTGACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130385813_1130385821 23 Left 1130385813 15:83411028-83411050 CCACCACGCCCAGTTAATTTTTG 0: 422
1: 19558
2: 85018
3: 154411
4: 203151
Right 1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG No data
1130385815_1130385821 15 Left 1130385815 15:83411036-83411058 CCCAGTTAATTTTTGTATTTTTT 0: 298
1: 10734
2: 89583
3: 157638
4: 133815
Right 1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG No data
1130385814_1130385821 20 Left 1130385814 15:83411031-83411053 CCACGCCCAGTTAATTTTTGTAT 0: 419
1: 19349
2: 69982
3: 97035
4: 123943
Right 1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG No data
1130385816_1130385821 14 Left 1130385816 15:83411037-83411059 CCAGTTAATTTTTGTATTTTTTT 0: 151
1: 4499
2: 19156
3: 125580
4: 114438
Right 1130385821 15:83411074-83411096 GGGTTTAACCACATTGACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130385821 Original CRISPR GGGTTTAACCACATTGACCA GGG Intergenic
No off target data available for this crispr