ID: 1130385935

View in Genome Browser
Species Human (GRCh38)
Location 15:83412281-83412303
Sequence ACCTATAGATTACTTTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130385930_1130385935 13 Left 1130385930 15:83412245-83412267 CCACAAAAATGTCCTTTGGGATT No data
Right 1130385935 15:83412281-83412303 ACCTATAGATTACTTTGGGGAGG No data
1130385927_1130385935 23 Left 1130385927 15:83412235-83412257 CCATCTGTTTCCACAAAAATGTC No data
Right 1130385935 15:83412281-83412303 ACCTATAGATTACTTTGGGGAGG No data
1130385931_1130385935 1 Left 1130385931 15:83412257-83412279 CCTTTGGGATTTTGATTGATATT No data
Right 1130385935 15:83412281-83412303 ACCTATAGATTACTTTGGGGAGG No data
1130385926_1130385935 24 Left 1130385926 15:83412234-83412256 CCCATCTGTTTCCACAAAAATGT No data
Right 1130385935 15:83412281-83412303 ACCTATAGATTACTTTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130385935 Original CRISPR ACCTATAGATTACTTTGGGG AGG Intergenic
No off target data available for this crispr