ID: 1130389714

View in Genome Browser
Species Human (GRCh38)
Location 15:83445076-83445098
Sequence CAAGGGCAGCATCTGATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130389714_1130389722 25 Left 1130389714 15:83445076-83445098 CCACCAATCAGATGCTGCCCTTG No data
Right 1130389722 15:83445124-83445146 TGAAAGGGCAGCCTTCATTCTGG No data
1130389714_1130389719 9 Left 1130389714 15:83445076-83445098 CCACCAATCAGATGCTGCCCTTG No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data
1130389714_1130389716 -8 Left 1130389714 15:83445076-83445098 CCACCAATCAGATGCTGCCCTTG No data
Right 1130389716 15:83445091-83445113 TGCCCTTGCTACTATGCAGCTGG No data
1130389714_1130389720 10 Left 1130389714 15:83445076-83445098 CCACCAATCAGATGCTGCCCTTG No data
Right 1130389720 15:83445109-83445131 GCTGGAGTGACTGCCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130389714 Original CRISPR CAAGGGCAGCATCTGATTGG TGG (reversed) Intergenic
No off target data available for this crispr