ID: 1130389718

View in Genome Browser
Species Human (GRCh38)
Location 15:83445094-83445116
Sequence ACTCCAGCTGCATAGTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130389718_1130389725 21 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389725 15:83445138-83445160 TCATTCTGGTAGCCATGGCCAGG No data
1130389718_1130389727 30 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389727 15:83445147-83445169 TAGCCATGGCCAGGGCTCAGTGG No data
1130389718_1130389719 -9 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data
1130389718_1130389720 -8 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389720 15:83445109-83445131 GCTGGAGTGACTGCCTGAAAGGG No data
1130389718_1130389726 22 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389726 15:83445139-83445161 CATTCTGGTAGCCATGGCCAGGG No data
1130389718_1130389723 16 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389723 15:83445133-83445155 AGCCTTCATTCTGGTAGCCATGG No data
1130389718_1130389722 7 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389722 15:83445124-83445146 TGAAAGGGCAGCCTTCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130389718 Original CRISPR ACTCCAGCTGCATAGTAGCA AGG (reversed) Intergenic
No off target data available for this crispr