ID: 1130389719

View in Genome Browser
Species Human (GRCh38)
Location 15:83445108-83445130
Sequence AGCTGGAGTGACTGCCTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130389715_1130389719 6 Left 1130389715 15:83445079-83445101 CCAATCAGATGCTGCCCTTGCTA No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data
1130389718_1130389719 -9 Left 1130389718 15:83445094-83445116 CCTTGCTACTATGCAGCTGGAGT No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data
1130389717_1130389719 -8 Left 1130389717 15:83445093-83445115 CCCTTGCTACTATGCAGCTGGAG No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data
1130389714_1130389719 9 Left 1130389714 15:83445076-83445098 CCACCAATCAGATGCTGCCCTTG No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data
1130389713_1130389719 22 Left 1130389713 15:83445063-83445085 CCATGGAGTGAATCCACCAATCA No data
Right 1130389719 15:83445108-83445130 AGCTGGAGTGACTGCCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130389719 Original CRISPR AGCTGGAGTGACTGCCTGAA AGG Intergenic
No off target data available for this crispr