ID: 1130391146

View in Genome Browser
Species Human (GRCh38)
Location 15:83456454-83456476
Sequence CAGCGCGATTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130391143_1130391146 13 Left 1130391143 15:83456418-83456440 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1130391139_1130391146 29 Left 1130391139 15:83456402-83456424 CCCAGCCTCGTTGCCACCTTGCA 0: 19
1: 912
2: 1931
3: 1661
4: 1144
Right 1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1130391140_1130391146 28 Left 1130391140 15:83456403-83456425 CCAGCCTCGTTGCCACCTTGCAG 0: 19
1: 891
2: 1887
3: 1606
4: 1111
Right 1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1130391141_1130391146 24 Left 1130391141 15:83456407-83456429 CCTCGTTGCCACCTTGCAGTTTG 0: 17
1: 856
2: 1865
3: 1609
4: 1162
Right 1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1130391138_1130391146 30 Left 1130391138 15:83456401-83456423 CCCCAGCCTCGTTGCCACCTTGC 0: 19
1: 892
2: 1908
3: 1667
4: 1247
Right 1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1130391142_1130391146 16 Left 1130391142 15:83456415-83456437 CCACCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1130391146 15:83456454-83456476 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130391146 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG Intronic
Too many off-targets to display for this crispr