ID: 1130394083

View in Genome Browser
Species Human (GRCh38)
Location 15:83486937-83486959
Sequence AGCACACCGGCCCCATCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130394078_1130394083 -2 Left 1130394078 15:83486916-83486938 CCTCTCTTCCTCTTCTTTATAAG 0: 1
1: 0
2: 5
3: 87
4: 565
Right 1130394083 15:83486937-83486959 AGCACACCGGCCCCATCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 98
1130394079_1130394083 -10 Left 1130394079 15:83486924-83486946 CCTCTTCTTTATAAGCACACCGG 0: 1
1: 1
2: 2
3: 15
4: 132
Right 1130394083 15:83486937-83486959 AGCACACCGGCCCCATCATGGGG 0: 1
1: 0
2: 0
3: 9
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130394083 Original CRISPR AGCACACCGGCCCCATCATG GGG Intronic