ID: 1130395155

View in Genome Browser
Species Human (GRCh38)
Location 15:83494965-83494987
Sequence CTGGAAGGGGGAGAGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3995
Summary {0: 1, 1: 1, 2: 40, 3: 429, 4: 3524}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130395155_1130395165 -1 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395165 15:83494987-83495009 GATGCTCCTTCCCTTGGTGCTGG 0: 1
1: 0
2: 3
3: 19
4: 182
1130395155_1130395173 18 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395173 15:83495006-83495028 CTGGGCACAGGAAGGACAGGTGG 0: 1
1: 1
2: 3
3: 68
4: 621
1130395155_1130395171 10 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395171 15:83494998-83495020 CCTTGGTGCTGGGCACAGGAAGG 0: 1
1: 0
2: 2
3: 51
4: 398
1130395155_1130395172 15 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395172 15:83495003-83495025 GTGCTGGGCACAGGAAGGACAGG 0: 1
1: 0
2: 4
3: 50
4: 475
1130395155_1130395163 -7 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395163 15:83494981-83495003 CTTCCAGATGCTCCTTCCCTTGG 0: 1
1: 0
2: 2
3: 39
4: 367
1130395155_1130395168 6 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395168 15:83494994-83495016 CTTCCCTTGGTGCTGGGCACAGG 0: 1
1: 0
2: 5
3: 27
4: 418
1130395155_1130395174 23 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395174 15:83495011-83495033 CACAGGAAGGACAGGTGGAGAGG 0: 1
1: 0
2: 6
3: 73
4: 684
1130395155_1130395166 0 Left 1130395155 15:83494965-83494987 CCTCCTCCCTCTCCCCCTTCCAG 0: 1
1: 1
2: 40
3: 429
4: 3524
Right 1130395166 15:83494988-83495010 ATGCTCCTTCCCTTGGTGCTGGG 0: 1
1: 0
2: 1
3: 16
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130395155 Original CRISPR CTGGAAGGGGGAGAGGGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr