ID: 1130395811

View in Genome Browser
Species Human (GRCh38)
Location 15:83500451-83500473
Sequence CCTGAAGGCCACATTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130395811_1130395820 25 Left 1130395811 15:83500451-83500473 CCTGGACCAATGTGGCCTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1130395820 15:83500499-83500521 GCCATATCTCTCTCCACTATTGG 0: 1
1: 0
2: 0
3: 12
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130395811 Original CRISPR CCTGAAGGCCACATTGGTCC AGG (reversed) Intronic
900361215 1:2289942-2289964 CCTCCAGGCCACGTTGCTCCAGG + Intronic
904603479 1:31686107-31686129 CCTGCTGGCCCCACTGGTCCTGG + Exonic
909287245 1:73836024-73836046 CCTTAATCCCACATTGCTCCTGG - Intergenic
915309407 1:154999821-154999843 CCTGAAGGCCTCATTCCCCCAGG + Intergenic
915983348 1:160437680-160437702 CCTCAAGGCCACATAGCTACTGG - Intergenic
919053586 1:192541346-192541368 ACTGAAGGGAACATTGCTCCAGG - Intergenic
922092982 1:222415163-222415185 CCTCAAGGCCAGATAGGTACAGG - Intergenic
1064369059 10:14735202-14735224 CCTATAGGCCACATGGGGCCTGG + Intronic
1067905375 10:50285306-50285328 CCTCAAGGCCACCCTGGTGCGGG + Intergenic
1070976728 10:80611314-80611336 CATGGACGCCACATTGGTTCTGG - Intronic
1072371108 10:94767256-94767278 CCTGAAGGCCACAATCCTCAGGG - Intronic
1073494121 10:103876168-103876190 CCAGAAGGGCATATAGGTCCGGG - Intergenic
1075261294 10:120965648-120965670 CCTTCAGGTCACATTGCTCCAGG - Intergenic
1076784960 10:132745228-132745250 CCTGGAGGCCACGATGCTCCTGG + Intronic
1077418577 11:2437439-2437461 CCTGAATCCCACAGTGGTGCAGG - Intergenic
1078170632 11:8926501-8926523 CCTGCAGGCCACTGTAGTCCAGG - Intronic
1080984559 11:37445947-37445969 CCTAAAGGCAACATTGGCCAGGG - Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1084265318 11:68002700-68002722 CCTGAAGGCCACAGTGGCTCTGG + Intronic
1085759344 11:79228353-79228375 CCTGTGGGCGACATTGGTCTGGG - Intronic
1088713670 11:112529933-112529955 GCTGAAGGTAACATTGGTCCTGG + Intergenic
1096529806 12:52235402-52235424 CATGAGGGTCACATTGGCCCGGG - Intronic
1098439762 12:70504989-70505011 CCTGAGGGCCACATGGGGCAGGG - Intergenic
1104881646 12:132075493-132075515 TCTCAAGACCACAATGGTCCAGG - Intronic
1105209389 13:18248956-18248978 CCTGGGGGCCACATGGGGCCTGG + Intergenic
1105250917 13:18697981-18698003 CCTGCAGGCCTCAGTGCTCCTGG - Intergenic
1107064766 13:36201154-36201176 CCAGAAGGCCCCATGGCTCCAGG + Intronic
1110008130 13:70297467-70297489 CCTGGAGCCCACAATGGTGCAGG - Intergenic
1110794625 13:79622194-79622216 CCTGAAAACCACATTTGTTCTGG + Intergenic
1112132219 13:96536729-96536751 CCTGAGGGCCACATTCTACCTGG - Intronic
1113420698 13:110169735-110169757 CCTGGAGGCCCCATGGGTCCCGG + Exonic
1113848836 13:113406794-113406816 CCTGAACGCTCCATCGGTCCAGG - Intergenic
1115979230 14:39030694-39030716 CCTGAAGGCCCCACTGATCTGGG - Intergenic
1116697905 14:48200585-48200607 CCTGGAGGCCACATTTCTCAGGG + Intergenic
1117097332 14:52312275-52312297 CCCCAAAGCCACCTTGGTCCTGG - Intergenic
1119544976 14:75464998-75465020 CCTGATGGTCACAGTGGCCCTGG + Intronic
1121861873 14:97326230-97326252 CCTGCATGCCACATTGATGCTGG + Intergenic
1121905781 14:97741507-97741529 CCTGAAAGCCACATAGGGCGGGG - Intergenic
1123135296 14:106022229-106022251 TCTGAGGGCCTCATGGGTCCTGG + Intergenic
1123164665 14:106314903-106314925 TCTGAGGGCCTCATGGGTCCTGG + Intergenic
1123397923 15:19955559-19955581 TCTGAGGGCCTCATGGGTCCTGG + Intergenic
1123585837 15:21760089-21760111 TCTGAGGGCCTCATGGGTCCTGG + Intergenic
1123622479 15:22202677-22202699 TCTGAGGGCCTCATGGGTCCTGG + Intergenic
1126108358 15:45161676-45161698 TCTGGAGGCCACATTGTTGCTGG + Intronic
1126349546 15:47730327-47730349 TGTGAAGGCCACAGTGGTGCAGG + Intronic
1129704685 15:77787488-77787510 CCAGAAGGACACAGGGGTCCCGG + Intronic
1130395811 15:83500451-83500473 CCTGAAGGCCACATTGGTCCAGG - Intronic
1132460803 16:53655-53677 CCTCGAGCTCACATTGGTCCTGG + Intronic
1134535555 16:15024120-15024142 TCTGTAGGCCACACTGGCCCAGG + Intronic
1134824346 16:17272495-17272517 CCTGAAGGAGCCATTGGTCCCGG - Intronic
1138592837 16:58011761-58011783 CCTGGAGCCCACATTCCTCCAGG + Intronic
1139373160 16:66480742-66480764 TGTGAAGGCCACCTTGGGCCGGG - Exonic
1139860488 16:70016663-70016685 TCTGTAGGCCACACTGGCCCAGG - Intergenic
1140253834 16:73318054-73318076 CCAGAAGTGCACATTAGTCCTGG + Intergenic
1141993608 16:87623484-87623506 CCTCAAGCCCACAGTGGTACTGG - Intronic
1142127227 16:88416198-88416220 CATGTAGGCCTCATCGGTCCCGG + Intergenic
1143220171 17:5255039-5255061 CCTGAAGGCCAGTTGGGTGCAGG - Intergenic
1144088854 17:11835287-11835309 CCTAAAGGGCAAAATGGTCCTGG - Intronic
1144723111 17:17485926-17485948 CCGGAAGGCCTCATAGGTCTTGG + Intronic
1145043100 17:19591480-19591502 CCTGAAGGGCAAATGGGCCCTGG - Intergenic
1151703925 17:75757042-75757064 CCCGAAGCCCTCAGTGGTCCTGG - Exonic
1152075223 17:78155228-78155250 CCTGGAGGCAAAATTGCTCCTGG + Intronic
1153046155 18:857255-857277 CCTGTAGGCCACAGTGCTGCTGG - Intergenic
1154142152 18:11833683-11833705 CCTGAAGGCCATCCTGTTCCAGG - Intronic
1154437928 18:14360933-14360955 CCTGCAGGCCTCAGTGCTCCTGG + Intergenic
1156149324 18:34223807-34223829 CCCGAAGGGCACACGGGTCCCGG + Intronic
1157947007 18:51991640-51991662 CCTGAAGGTCATATTTGGCCAGG - Intergenic
1160323250 18:77915725-77915747 CCTGAAGGCCACGTTTATCCAGG - Intergenic
1161144667 19:2670603-2670625 TCTGAGGGTCACTTTGGTCCAGG + Intronic
1161278042 19:3429848-3429870 CCTGAGGGCCACGATGTTCCCGG - Intronic
1161735874 19:5991793-5991815 CCTGCAGTCCACACTGGGCCTGG + Intergenic
1164999029 19:32745267-32745289 CCGGAAGCCCACATTTGTTCTGG - Intronic
1165103794 19:33456819-33456841 ACTGATGCCCACATTTGTCCAGG + Intronic
1165755934 19:38293008-38293030 CCTGAAGGCCAAATTCAGCCGGG - Intronic
1165771590 19:38383651-38383673 CCTGCAGGCCACAGTGCTGCTGG - Exonic
1166338655 19:42123772-42123794 GCTGAAGCCCAGATTTGTCCTGG - Intronic
1168611281 19:57802569-57802591 CCTGAAGGCCACAGTGAGCAAGG - Intronic
925685445 2:6467793-6467815 TCTCATGGCCACATTGATCCAGG - Intergenic
926008796 2:9392719-9392741 GCTGAAGGCCTCATTCTTCCTGG + Intronic
926376242 2:12230867-12230889 CCTGTGGGCCACATGCGTCCGGG - Intergenic
926427834 2:12755445-12755467 CCAGAAGTCCACATGGGTCCTGG + Intergenic
928801757 2:35102533-35102555 ACTGAAGGGAATATTGGTCCGGG - Intergenic
931571568 2:63674113-63674135 TCCCAAGGCCACATTGGTCTGGG + Intronic
936166422 2:110124027-110124049 CCTGAAGTCCACGTTTCTCCTGG - Exonic
942044985 2:172094979-172095001 CCAGAAGTCCCCATTGTTCCGGG + Intergenic
944382400 2:199126717-199126739 TCTCAAGTCCACATTGATCCGGG - Intergenic
945038883 2:205728064-205728086 CCTTAAAGGCACATTGGACCAGG + Intronic
945371771 2:209027212-209027234 CCTGAAGCCAATATTGGCCCTGG - Intergenic
947151503 2:227121075-227121097 CCTGAAAGCCCAATGGGTCCTGG + Exonic
947909102 2:233790037-233790059 CCAGAAGGGCACACTGGGCCCGG - Intronic
948147370 2:235717607-235717629 CCTGACGGGCACATATGTCCAGG + Exonic
948617761 2:239212518-239212540 TCTGAAGGCCAGAATGGCCCAGG + Intronic
1170981471 20:21218254-21218276 CCTGAAGATCTCATTGGTCAAGG + Intronic
1171088971 20:22266476-22266498 CCTGAAGGACACATATCTCCTGG - Intergenic
1176079979 20:63267628-63267650 CTTGAAAGCCCCTTTGGTCCTGG - Intronic
1176744604 21:10640281-10640303 TCTGAGGGCCTCATGGGTCCTGG + Intergenic
1177958660 21:27633921-27633943 CCTGAAGGCAAAATTGCCCCTGG + Intergenic
1179226062 21:39454546-39454568 CCAGAAGGCCACAGTGGGGCAGG + Intronic
1179996619 21:44977281-44977303 CCTGCAGGCCTCAGTGCTCCTGG - Intergenic
1181052083 22:20242703-20242725 CCTGCAGGCCGCAGCGGTCCAGG + Exonic
1181648098 22:24244608-24244630 CCTGGGGGCCACATGGGGCCTGG + Exonic
1183522530 22:38303673-38303695 CCTGTAGGCCAGGGTGGTCCTGG - Intronic
1184597940 22:45525657-45525679 CCTGGAGGCCACATTTGTGAAGG + Exonic
1185050003 22:48549325-48549347 CCTGAAGCTCATATTGTTCCGGG - Intronic
1185126902 22:49016451-49016473 CATGAAGGCAACTTTGCTCCGGG + Intergenic
950864175 3:16175610-16175632 CCTGGAGGCCACGTGGGTCCAGG - Exonic
952903044 3:38122086-38122108 CCTGAAGGCCACAGCGGCCTTGG - Exonic
953875210 3:46662687-46662709 CCCGAAGGCAACATGGGTCTTGG - Intergenic
955064272 3:55521211-55521233 CCTGTCGGCCACCTGGGTCCAGG + Intronic
955893585 3:63675620-63675642 TCTGAAGGGCACCTTGGTCTTGG + Intronic
955909565 3:63846298-63846320 CCTGAAGTCCATTTTTGTCCAGG - Intronic
956808178 3:72838013-72838035 CCTGAAGCTCACCTTGCTCCAGG - Intronic
959461263 3:106628712-106628734 CCTGAAGGGCAGGTTGCTCCAGG + Intergenic
962366701 3:134791421-134791443 CCTGAAGGCACCATTGGTTTGGG - Intronic
965559591 3:170048787-170048809 CCTGAAGAGGACATTTGTCCTGG - Intronic
966539719 3:181075583-181075605 CCTGAGAGCCACATGGGTCAGGG - Intergenic
968322958 3:197787696-197787718 CCTGTAAGCCACTTTGCTCCTGG + Intergenic
968398011 4:261414-261436 CCTGAAAGCCACAATCTTCCAGG + Intergenic
968746682 4:2364119-2364141 CCAGAAGGCCACAGTGAGCCTGG - Intronic
969469938 4:7381805-7381827 CCTGAAGGCCACCATGTGCCAGG + Intronic
975734494 4:77367879-77367901 GCTGAGGGCCACAGTAGTCCGGG + Intronic
976728799 4:88242334-88242356 GCTGAATGCCATATTGGTTCAGG + Intergenic
977781573 4:100986762-100986784 CCTGATGGCCACTTTGGCGCTGG - Intergenic
977969895 4:103200984-103201006 CCACAAGGCCCCATGGGTCCTGG - Intergenic
981027353 4:140090307-140090329 CATGAAGGCCACACAGGTCCTGG - Intronic
982143415 4:152353731-152353753 CCAGAAGGCAACATTTTTCCTGG + Intronic
983301141 4:165927659-165927681 CCTGGAGGCAAAATTGCTCCTGG - Intronic
988943639 5:36171749-36171771 TGTGAAGGCCTCAGTGGTCCAGG - Intronic
989460785 5:41696379-41696401 CCTGAATCCCACCTTGGACCTGG - Intergenic
992127390 5:73655834-73655856 CCTGAAGGCCAAATTCTACCCGG + Intronic
992255468 5:74916564-74916586 CCTTCAGGCCCCATTGCTCCAGG + Intergenic
992608006 5:78481146-78481168 CTTAAAGTCCACATTGGTACTGG + Intergenic
993232233 5:85250111-85250133 CCTGATGGCAACATGGGTCAGGG + Intergenic
997716946 5:136049503-136049525 CTCGAAGGCCTCATTGGTCGGGG - Exonic
1000686735 5:164259172-164259194 TCTGGAGCCCACAGTGGTCCAGG - Intergenic
1002109198 5:176896724-176896746 CCTGAAGGCAACAGGGGTCATGG + Intronic
1005850555 6:29817574-29817596 CCTGAAGGACCCATTTGGCCTGG + Intergenic
1010370503 6:75101607-75101629 CCTGGAGGTCCCATTGGTCCTGG + Exonic
1010758809 6:79698654-79698676 CCTGCAGGCCACATTGGCCCTGG + Intronic
1015526391 6:134178112-134178134 CCTGAATGCCACGTTCCTCCCGG - Intronic
1017008137 6:150043050-150043072 CTTGAAGGCCAGATGTGTCCAGG - Intergenic
1017484571 6:154890825-154890847 CCTGAAGGTGACCTTTGTCCAGG - Intronic
1019300244 7:299399-299421 CCTAAAGGCCCCCTTGGCCCTGG - Intergenic
1020080615 7:5283947-5283969 CCTGAAGTGCACAGTGGCCCAGG - Intronic
1021893623 7:25212336-25212358 CGTGAAGGCAACAGTGGTGCAGG + Intergenic
1023333031 7:39139506-39139528 GCTAAAAGCCACATTGCTCCTGG + Intronic
1026976324 7:74501078-74501100 CTGTAGGGCCACATTGGTCCTGG + Intronic
1028588104 7:92470960-92470982 CCTGAAGGCCACAGTCCTCAGGG - Exonic
1032777517 7:135129063-135129085 ACTGAAGGGCACTTTGGTTCTGG - Intronic
1037679719 8:21086827-21086849 CCTGCAGGCCACAGAGGGCCTGG + Intergenic
1039337689 8:36610935-36610957 CCTGAAGAGCACTTTGGTCAGGG + Intergenic
1041920215 8:63173869-63173891 CCTGAAGGTCAACTTGATCCTGG - Intronic
1043383044 8:79723268-79723290 CCTCAAGCCCAGATTGGTCTGGG + Intergenic
1045692201 8:104771447-104771469 CCTGATGACCACATTGGAGCAGG - Intronic
1047819922 8:128507631-128507653 CCTGAAGGACACAGTGTGCCTGG + Intergenic
1050153700 9:2643386-2643408 GCTGACGGCCACACTGCTCCAGG - Exonic
1052381259 9:27773421-27773443 CCCCAAGGCCACATTCTTCCTGG - Intergenic
1054977822 9:71169266-71169288 CCTGAGGGTCACATTTGACCTGG - Intronic
1056541912 9:87578982-87579004 CCTAAATGCCACACTGGTCTAGG - Intronic
1059349919 9:113657115-113657137 TCTGAAGCCCACCTGGGTCCTGG - Intergenic
1059848228 9:118305340-118305362 CCTGTAGGTCACATTTGTACAGG + Intergenic
1060277677 9:122194151-122194173 CCTGAAGTGCACCTGGGTCCTGG + Intronic
1061883634 9:133580034-133580056 CCTGAAGGTCACAAGGGTCACGG - Intronic
1187272214 X:17789420-17789442 CCTGAAGGCAAAATTGGGCCTGG - Intergenic
1188884240 X:35530957-35530979 CCTGAAAGCCACATGGGGCAGGG + Intergenic
1189257730 X:39653406-39653428 GTTGAAGGTCACATTGCTCCTGG + Intergenic
1190958550 X:55221584-55221606 CATGAAGGCAACTTTGGTTCAGG + Intronic
1192760204 X:74088498-74088520 CCTGAAGGCAACAGTGGTGAGGG - Intergenic
1193768624 X:85561667-85561689 CCTGAAAGCCACATGGGACAGGG - Intergenic
1195245578 X:102992363-102992385 CCTTAAGGTCCCATTGTTCCAGG + Intergenic
1195662181 X:107390047-107390069 GCAGAAGGCCACATTGGTGTGGG + Intergenic
1195793317 X:108614934-108614956 CCAGGAGGTCCCATTGGTCCAGG - Exonic
1197656875 X:129126352-129126374 ACTGAAGGCTATATGGGTCCAGG - Intergenic
1199745926 X:150771968-150771990 CCTGAGGGCCACAGTGGTGGGGG + Intronic
1201070968 Y:10147073-10147095 CATGAAAGCTTCATTGGTCCAGG - Intergenic
1201407086 Y:13660338-13660360 CCTGAAGGCCACAATCCTCAGGG - Intergenic