ID: 1130397058

View in Genome Browser
Species Human (GRCh38)
Location 15:83511932-83511954
Sequence GGAACAATACTGGACCTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130397055_1130397058 3 Left 1130397055 15:83511906-83511928 CCGGGTAAGAGGGGAGTTTGACA 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1130397058 15:83511932-83511954 GGAACAATACTGGACCTAAAAGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130397058 Original CRISPR GGAACAATACTGGACCTAAA AGG Intronic
901337857 1:8466743-8466765 GAAACAAGTCTGGTCCTAAAGGG - Intronic
907683660 1:56588734-56588756 GGAACAATACATGGCCAAAAAGG + Intronic
908910791 1:69070985-69071007 GGAACAAAACTGGACAGAGAAGG - Intergenic
910926325 1:92401555-92401577 AGAACAATACTGGATATAAGTGG + Exonic
911292497 1:96074352-96074374 GGAATAATACTGTATTTAAAGGG - Intergenic
913275398 1:117133081-117133103 GGAGCAATATTGCCCCTAAATGG + Intergenic
914948031 1:152083893-152083915 GGAAGAATACTGAACCTCGAAGG + Intergenic
917754055 1:178081744-178081766 GAAACAATACTGAATGTAAAAGG + Intergenic
918018460 1:180661333-180661355 GTAATAATACTGAACATAAATGG - Intronic
919070969 1:192754422-192754444 TGAACAATATTGGTCCTATACGG - Intergenic
921700394 1:218262754-218262776 AGAATAATCCTGGACCTGAACGG - Intergenic
922846103 1:228685490-228685512 GAAACAAAACTGGAACCAAATGG + Intergenic
924349677 1:243102675-243102697 GTAATAATACTTAACCTAAAAGG + Intergenic
1065294754 10:24263669-24263691 GAAACAATACTGGTCTTAGAAGG - Intronic
1067537881 10:47128431-47128453 GAAACAATACATGACCTAAAGGG + Intergenic
1068651717 10:59529324-59529346 GGAACAAAACTGGACAGAGAAGG + Intergenic
1069166109 10:65161824-65161846 GGAAAAATACAGGGCCAAAAGGG + Intergenic
1069852086 10:71414322-71414344 GGAACAAAAGTGGCCATAAATGG - Intronic
1070230081 10:74556757-74556779 ACAACAATAATGGACATAAAAGG - Intronic
1070994749 10:80767150-80767172 GAAACAACACTTTACCTAAAGGG - Intergenic
1071936760 10:90540510-90540532 GGAACAATCATGGAGATAAAAGG - Intergenic
1072926083 10:99618810-99618832 GAAACAGTACTGGAACCAAAGGG + Intronic
1075675849 10:124295258-124295280 GGAACACTACTGGGGCTCAAGGG + Intergenic
1082182252 11:49133740-49133762 GGAATTATACTTGACCCAAATGG + Intergenic
1085996581 11:81923399-81923421 GGAACAATATCGGATCTCAAGGG - Intergenic
1088164993 11:106924513-106924535 AGGACAATATTGGACCCAAATGG - Intronic
1089888156 11:121850129-121850151 TTAACAATACTGGAACTAAAAGG - Intergenic
1090106684 11:123860680-123860702 GAAACAATAATAGACTTAAAAGG + Intergenic
1096752609 12:53771588-53771610 AGAAAAATAATGGACCTACATGG - Intergenic
1099699250 12:86062502-86062524 GGAACAAAACTGGACAGAGAAGG + Intronic
1106689433 13:32097797-32097819 TGAACATTTCTGGAACTAAAAGG + Intronic
1109828773 13:67757685-67757707 GGAAAAATAATGGACCTACATGG + Intergenic
1110133216 13:72032769-72032791 GGTAGAATACTGCACCCAAAAGG - Intergenic
1110403699 13:75123654-75123676 AGAACAATGCTGGGCCTAATAGG + Intergenic
1111838076 13:93413839-93413861 GGAATAATTCTGCACTTAAAAGG + Intronic
1112139481 13:96622492-96622514 AGAAAAATACTTGACATAAATGG + Intronic
1202928829 14_KI270725v1_random:20782-20804 GTAACAAAACTGGACATGAAAGG - Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1128609360 15:69061634-69061656 GGAAAAATACTCAACCTGAATGG + Intronic
1130397058 15:83511932-83511954 GGAACAATACTGGACCTAAAAGG + Intronic
1130442051 15:83964149-83964171 GGAACAAAACTGGACAGAGAAGG + Intronic
1132246112 15:100297516-100297538 GGAACAATACTGGGGCTATTTGG + Intronic
1137295949 16:47093511-47093533 GGAACAGTACCTGCCCTAAAGGG - Intronic
1144428417 17:15167787-15167809 GGAACAATACTGAGACTCAAAGG - Intergenic
1146020787 17:29276938-29276960 GGAAAAAGACTGAAGCTAAAAGG + Intronic
1147431299 17:40372337-40372359 AAAACAATTCTGGACCCAAAGGG + Intergenic
1164347587 19:27285542-27285564 GGAACAAAGCTGGACATAGAAGG - Intergenic
1164962349 19:32444731-32444753 AGAAAAATACTGTACCTATAGGG + Intronic
1166256429 19:41608408-41608430 CAAACAATAGTGGATCTAAAAGG - Intronic
927002044 2:18806686-18806708 GGAATATTACCAGACCTAAAGGG + Intergenic
929547840 2:42867382-42867404 GGAACCACACGGGACCCAAACGG - Intergenic
930573280 2:53113353-53113375 GGAACATTTATGGACCTTAAAGG + Intergenic
931605943 2:64052090-64052112 GGAACATGACTGGACAAAAAGGG - Intergenic
936640147 2:114303331-114303353 GGAACAAAACTGGACAGAGAAGG - Intergenic
937821074 2:126311863-126311885 GCAACTATACTGGAACTAATAGG - Intergenic
938162304 2:128996955-128996977 GGAAACATGCTGGACTTAAAAGG + Intergenic
938884725 2:135632828-135632850 AGAAAAATAATGGACCAAAAAGG - Intronic
939563503 2:143759206-143759228 GGTACAATATTGCTCCTAAATGG + Intronic
939866688 2:147480964-147480986 GAAATGATACTGGACCTACAAGG + Intergenic
941323656 2:164086459-164086481 GGAACTACACTAGACATAAAAGG + Intergenic
944451905 2:199851720-199851742 GGAACAAAATTGGATCAAAATGG - Intergenic
1170981245 20:21215441-21215463 GAAACAATACTGTTCCTAAAAGG - Intronic
1176590850 21:8649369-8649391 GTAACAAAACTGGACATGAAAGG - Intergenic
1177144291 21:17390925-17390947 GGAACAATCCTGAACCAGAAAGG - Intergenic
1180273679 22:10626402-10626424 GTAACAAAACTGGACATGAAAGG - Intergenic
1181568623 22:23754251-23754273 GGAACAGTACTGGCCCCAGAAGG - Intronic
1182792836 22:32967266-32967288 GGGCCAAGACTGGACCAAAACGG + Intronic
949136415 3:572309-572331 GTAACAAAACTGGACATGAAAGG + Intergenic
950577069 3:13838343-13838365 GGAGCAACAGTGGACCTGAAAGG + Intronic
950666728 3:14500514-14500536 GGAACAACAATGAACCTAACAGG + Intronic
952546509 3:34425774-34425796 GGCAGAATAATGGACCTCAAAGG + Intergenic
952593296 3:34983994-34984016 GGAACAATATAGGACTTAACTGG + Intergenic
956103263 3:65790456-65790478 GGACCATTACTGGACTTCAAAGG - Intronic
957172598 3:76757889-76757911 GGAACAATATTTTTCCTAAAAGG + Intronic
957684387 3:83482059-83482081 GGAAAAATACTGAACTTAGAGGG - Intergenic
961499092 3:127318298-127318320 GGAACAATACTTTACTTACACGG - Intergenic
975997806 4:80336504-80336526 GGAGCGAAACTGGACCTAATGGG + Intronic
980472962 4:133273493-133273515 GAAATAATATTGGACCCAAATGG + Intergenic
982206843 4:153003016-153003038 TGAACAATGCTGGACGTAAGTGG + Intergenic
983272762 4:165582446-165582468 GGAAGAATACAGGGCATAAAAGG + Intergenic
983336341 4:166398253-166398275 GGAAGAATAGTGGACATCAAAGG + Intergenic
997131155 5:131277917-131277939 GAAACAATACTGGCACCAAAAGG + Intronic
998933913 5:147213839-147213861 TGAAAAATACTGGAGCTTAAAGG - Intergenic
1003424250 6:5986733-5986755 GGAACAATAACAGACATAAAGGG - Intergenic
1005105629 6:22221497-22221519 AGAACCATACTGGGCATAAAAGG - Intergenic
1014589356 6:123244220-123244242 GGAACAAAACTGGACAGAAAAGG + Intronic
1014991098 6:128077933-128077955 GGAACAATTCGGGAATTAAAAGG + Intronic
1016106300 6:140167501-140167523 GGAACAATAGTTGACATACATGG + Intergenic
1017942392 6:159064456-159064478 GTAACAATAATGGAAGTAAATGG + Intergenic
1027583014 7:80021250-80021272 GGAACAAAACTGGACAGAGAAGG + Intergenic
1029047191 7:97642473-97642495 GGAAAAATACTGGAATGAAAGGG - Intergenic
1029554585 7:101259648-101259670 GTCAAAATACAGGACCTAAATGG - Intergenic
1032647506 7:133841515-133841537 AGAATAAGAATGGACCTAAAAGG - Intronic
1032920531 7:136540745-136540767 GGAACAATCATGAAGCTAAAAGG + Intergenic
1033974728 7:147087176-147087198 GGAACAATACTTAACTCAAAGGG - Intronic
1038105638 8:24430917-24430939 GGAACTATTCTAGACCTTAAGGG + Intergenic
1038436875 8:27542482-27542504 GGAACACTAATGGAGCTAATAGG - Intronic
1042191620 8:66193043-66193065 TGACCAATACAGGAACTAAAAGG + Intergenic
1054866904 9:70012227-70012249 AGAACACTATTTGACCTAAAAGG + Intergenic
1203620864 Un_KI270749v1:128093-128115 GTAACAAAACTGGACATGAAAGG - Intergenic
1187188206 X:17008040-17008062 GGAAAAATATTGGACTTGAAAGG + Intronic
1192796563 X:74428479-74428501 GGAACAATACTGGGAAAAAAGGG - Intronic