ID: 1130397284

View in Genome Browser
Species Human (GRCh38)
Location 15:83513675-83513697
Sequence ATGGAGGGTCATGATTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130397284_1130397294 14 Left 1130397284 15:83513675-83513697 CCCACTAAATCATGACCCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1130397294 15:83513712-83513734 CACTCTACCCAGGGCATGGTAGG 0: 1
1: 0
2: 0
3: 14
4: 149
1130397284_1130397290 5 Left 1130397284 15:83513675-83513697 CCCACTAAATCATGACCCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1130397290 15:83513703-83513725 TCTACTTCCCACTCTACCCAGGG 0: 1
1: 0
2: 1
3: 20
4: 213
1130397284_1130397289 4 Left 1130397284 15:83513675-83513697 CCCACTAAATCATGACCCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1130397289 15:83513702-83513724 TTCTACTTCCCACTCTACCCAGG 0: 1
1: 0
2: 0
3: 15
4: 215
1130397284_1130397291 10 Left 1130397284 15:83513675-83513697 CCCACTAAATCATGACCCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1130397291 15:83513708-83513730 TTCCCACTCTACCCAGGGCATGG 0: 1
1: 0
2: 0
3: 29
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130397284 Original CRISPR ATGGAGGGTCATGATTTAGT GGG (reversed) Intronic
901019433 1:6248427-6248449 ATGGAGGGAGATGATGTGGTGGG + Exonic
901263805 1:7893818-7893840 AAGGACGGTCATATTTTAGTGGG - Intergenic
901959363 1:12812355-12812377 ATGGAAGTTCAGGATCTAGTTGG + Intergenic
907738066 1:57135237-57135259 ATGAAGTGTTATTATTTAGTAGG - Intronic
908317879 1:62951831-62951853 ATGAAAAGTCTTGATTTAGTTGG - Intergenic
910639262 1:89442144-89442166 ATGCAGAGTCTTGACTTAGTGGG + Intergenic
915845676 1:159261989-159262011 ATGGAGAGTTATTATTTAGTAGG + Intergenic
923475336 1:234326318-234326340 ATGGAGAGTTATTGTTTAGTGGG + Intergenic
923767904 1:236909995-236910017 TTGGAGGGTTATTGTTTAGTTGG - Intergenic
1070460568 10:76665163-76665185 ATGCAGAGTCATTATTTAATGGG + Intergenic
1070728085 10:78805710-78805732 ATGTTGGGTCATTGTTTAGTCGG - Intergenic
1073121952 10:101127385-101127407 CTGGAGGGTCAGGATTTGCTGGG - Intronic
1073738611 10:106380907-106380929 ATGGAATGTAATGATTCAGTGGG - Intergenic
1074885879 10:117693262-117693284 ATGGCAGATCTTGATTTAGTAGG + Intergenic
1076121854 10:127942725-127942747 ATGGAGGGTTATGTTTAAGAGGG + Intronic
1077804515 11:5576822-5576844 TTGGAGGTTCATTATTTAGGAGG + Intronic
1081215896 11:40397572-40397594 TTGGAGGGTCAGGAAGTAGTTGG + Intronic
1082745745 11:56960739-56960761 ATGCTAGGTGATGATTTAGTGGG - Intergenic
1083448272 11:62725627-62725649 ATGGAGAGTCATGGTATAATCGG - Intronic
1083704508 11:64504714-64504736 AGGGAGTGGCATGATTCAGTGGG + Intergenic
1086105257 11:83140432-83140454 AGGGGCAGTCATGATTTAGTGGG + Intergenic
1087148515 11:94836399-94836421 CTGTAAGGTCATGATTTATTTGG + Intronic
1087536549 11:99454261-99454283 ATAAAGGGTAATGATATAGTTGG + Intronic
1087577595 11:100009462-100009484 ATGGAGGGGGATTAATTAGTTGG + Intronic
1092863260 12:12737862-12737884 ATGGAGGGTCGTTATCTAGGGGG + Intronic
1092869280 12:12791940-12791962 AAGGAGGGTGATCATTAAGTAGG + Intronic
1097947014 12:65380291-65380313 TTGGGGGGTCCTGATATAGTTGG + Intronic
1100740913 12:97591591-97591613 AGGGAGAGGTATGATTTAGTGGG - Intergenic
1101800296 12:108016105-108016127 ATGGAGGATTATGATGGAGTGGG + Intergenic
1103535670 12:121632200-121632222 ATGGAGGGCCTTGATTGGGTGGG + Intronic
1106130779 13:26937575-26937597 ATGGAGTCTTATGATTTAGAAGG + Intergenic
1110013458 13:70368123-70368145 ATGGAGAGTTATTGTTTAGTGGG + Intergenic
1110780900 13:79463595-79463617 ATGGAGGGTTATTATTTAATGGG - Intergenic
1112540534 13:100307460-100307482 ATGGTGTGGCATGATTTAGTTGG - Intronic
1115151494 14:30291331-30291353 ATGGAGGGTAAGGATTTTGATGG + Intergenic
1117540017 14:56737864-56737886 CTGGAGGATAACGATTTAGTGGG + Intergenic
1121921284 14:97883852-97883874 ATGTAGGCACATGATTTAGAAGG - Intergenic
1128140237 15:65294722-65294744 ATGGGGAGTCATTATTTAATGGG + Intronic
1129884982 15:79031483-79031505 ATGGAGGGTCAGGATGTACCTGG + Exonic
1130397284 15:83513675-83513697 ATGGAGGGTCATGATTTAGTGGG - Intronic
1130560801 15:84956904-84956926 ATGGAGTGTCACAGTTTAGTTGG - Intergenic
1133559947 16:6941592-6941614 GAGGAGGGGCATAATTTAGTAGG - Intronic
1133916819 16:10116579-10116601 CTGGGGGGACATGGTTTAGTTGG + Intronic
1139182822 16:64767882-64767904 ATGGAGGGTAATGTTTGATTTGG + Intergenic
1139899844 16:70319375-70319397 ATGCAGGGTCTGAATTTAGTAGG + Intronic
1141149950 16:81557221-81557243 ATGGAGCTTCATGATCTCGTGGG - Intronic
1141353911 16:83325160-83325182 ATCTGGAGTCATGATTTAGTGGG - Intronic
1141862147 16:86724921-86724943 ATGGGGAGTTATAATTTAGTGGG + Intergenic
1144601131 17:16615063-16615085 ATGGAGAGTCATTGTTTAATGGG + Intergenic
1148882440 17:50740143-50740165 ATGATGCTTCATGATTTAGTAGG + Intronic
1149251908 17:54780015-54780037 ATGTAGGGTCATGATTCACATGG - Intergenic
1150715680 17:67570794-67570816 AGGGAGGATGATGATTTAGTAGG - Intronic
1155025721 18:21938762-21938784 ATGGACAGTCATGGTTTAATGGG + Intergenic
1156988239 18:43374902-43374924 ATGGTAAGTCATGATTTATTGGG + Intergenic
1157172991 18:45425204-45425226 ATGGAGGGTCAGCATTTGGATGG - Intronic
1165456914 19:35917430-35917452 ATGGTGAGTCATGATTTGATTGG + Intergenic
1167475308 19:49697199-49697221 CTGGAGGCTCAAGATCTAGTAGG - Intronic
925828088 2:7869984-7870006 ATGGTTGATCATGATTTTGTAGG - Intergenic
926943187 2:18159653-18159675 AAGGAGGTTCAGGAGTTAGTGGG + Intronic
930456553 2:51613970-51613992 ATGCAGAGTCATTACTTAGTGGG + Intergenic
931674541 2:64681235-64681257 ATGGAGAATCATCATTTAATAGG - Intronic
936990328 2:118357173-118357195 ATGGAGAGTTATCATTTGGTGGG - Intergenic
939663796 2:144924264-144924286 ATGGAGGGTCTTGATGTTGATGG - Intergenic
940656629 2:156494979-156495001 ATGGAAGGTCATTATTTTTTAGG + Intronic
941155801 2:161976463-161976485 ATGGAGAGTTGTGGTTTAGTGGG + Intronic
942331150 2:174825879-174825901 ATGGCTTGTCATGATTTAATTGG - Intronic
945597878 2:211817575-211817597 AGGGAGGGACAAGATTTAGGGGG - Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1172602203 20:36191538-36191560 CTGAAGGGTGCTGATTTAGTAGG - Intronic
1173174224 20:40752148-40752170 GTGGAGGGTCATAATCTATTGGG - Intergenic
1177061534 21:16380566-16380588 ATCCAAGGTCATGATTTAGGGGG - Intergenic
1177291256 21:19115551-19115573 ATGTAGAGTCATTGTTTAGTGGG - Intergenic
1178022407 21:28424522-28424544 TTGGAGGGTCATAAGTGAGTGGG - Intergenic
1181077314 22:20389585-20389607 AGGGAGGGTCATGATCAACTCGG - Exonic
1183359128 22:37374329-37374351 CAGGATGGTCATGATGTAGTGGG + Exonic
951421433 3:22490628-22490650 ATGGAGGGTCTTGAGGTAGGGGG - Intergenic
955876726 3:63498383-63498405 ATGGAGCTTCATGTTGTAGTGGG + Intronic
958722850 3:97866858-97866880 ATGGTGGTTCTTGATTTAGGAGG + Intronic
960751208 3:120956308-120956330 ATGGAGAGTTATAATTTAATGGG - Intronic
961019447 3:123492346-123492368 AAGGAAGGTCATGTTTTTGTGGG - Exonic
965046917 3:163590103-163590125 CTGGAGGGTCAACAATTAGTTGG + Intergenic
965844334 3:172944836-172944858 ATGGAGAGTTATTATTTAATGGG + Intronic
966987716 3:185197431-185197453 ATGGGGAGTTATCATTTAGTAGG - Intronic
967727761 3:192877930-192877952 AAGGAGGGTAATGATTTATTTGG - Intronic
969551994 4:7875933-7875955 ATGTAGGGTTATTATTTAATGGG + Intronic
970788665 4:19830509-19830531 ATGGAGGGTCAGGAGTTATAAGG - Intergenic
972054959 4:34790064-34790086 ATGGAAGGTCATGAATTGCTTGG - Intergenic
973935043 4:55837053-55837075 AATGAGAGACATGATTTAGTTGG - Intergenic
974895804 4:67936958-67936980 AGGGAAGGTCATTATTTAGAAGG + Intronic
975667929 4:76752305-76752327 ATGGGGAGTTATTATTTAGTGGG + Intronic
975981660 4:80167920-80167942 AAGGAGAGTTATGATTTAGTGGG - Intergenic
982711287 4:158760827-158760849 ATCCATGGTCATGATGTAGTAGG + Intergenic
989962675 5:50435235-50435257 ATAGACGGTAATGTTTTAGTGGG - Intronic
990521718 5:56587754-56587776 ATTGAGGGTGATGTTTTAGATGG + Intronic
990696660 5:58425742-58425764 ATAGATGTTCATGATTTGGTAGG - Intergenic
991328360 5:65463451-65463473 ATGGAGGGCCTGAATTTAGTGGG + Intronic
992048041 5:72917078-72917100 ATGGAAGGTGATGATAGAGTGGG + Intergenic
992378911 5:76217833-76217855 ATGGAGGATTCTGATTTATTGGG - Intronic
998506021 5:142673695-142673717 AGGCAGGGACATGATTTAGGGGG - Intronic
999636947 5:153632979-153633001 ATGGAGGGTCATTTTTGAGAAGG + Intronic
999718293 5:154379718-154379740 ATGGGGGGTCTTGACTTAGATGG - Intronic
1000464677 5:161561034-161561056 AAGGTGAGTCATGATTTAATAGG + Intronic
1001896091 5:175382545-175382567 TTGGAGTTACATGATTTAGTGGG - Intergenic
1006135547 6:31893853-31893875 ATGGAGAGTTATGTTTTAATGGG + Intronic
1009802873 6:68564433-68564455 ATGGAGTGTCAAGATTTCATTGG - Intergenic
1010267310 6:73881646-73881668 ATGGAGAGTCACTATTTAATGGG - Intergenic
1011113529 6:83864974-83864996 ATGGAGCCTCATGGTATAGTTGG - Intronic
1012031833 6:94079462-94079484 ATGGAAGTTCCTGATTTAATAGG - Intergenic
1012603630 6:101130540-101130562 TTGGAGGGTCATGATGTGTTGGG + Intergenic
1013650130 6:112186465-112186487 ATAGAAGCCCATGATTTAGTGGG + Intronic
1014698716 6:124656602-124656624 CTGTAGGTACATGATTTAGTTGG + Intronic
1019548290 7:1589125-1589147 ATTGTGGATCATGACTTAGTGGG + Intergenic
1019577783 7:1745843-1745865 CAGGATGGTCATGATGTAGTGGG - Exonic
1021732063 7:23605587-23605609 ATGGAAAGTTATGATTTAATGGG - Intronic
1024858877 7:53814553-53814575 ATGGAGACTCATGATATACTGGG - Intergenic
1026029757 7:66780505-66780527 ATGGAGTGTTATGTTTTTGTTGG + Intronic
1028566854 7:92243192-92243214 ATGGAGACTTAAGATTTAGTGGG - Intronic
1029813463 7:103071894-103071916 ATGGTGGGTCATGCTGTGGTGGG + Intronic
1032904529 7:136348836-136348858 ATGGAGGGTCGTGCTTTTGGAGG + Intergenic
1038570796 8:28660683-28660705 ATGGAGAGTTAGTATTTAGTGGG - Intronic
1039104516 8:33975648-33975670 ATGAAGGGCAATGATTTAATGGG - Intergenic
1039193935 8:35008977-35008999 TGGGAGGTTCATGATTTAGCAGG + Intergenic
1039585322 8:38702339-38702361 ATGGAGGATAATGGTTTAATGGG - Intergenic
1046197281 8:110882041-110882063 ATGCAGGGTCCCTATTTAGTGGG - Intergenic
1047197838 8:122737679-122737701 ATGGAGGGAAATGATTGAGGAGG + Intergenic
1048592406 8:135833039-135833061 ATGGAGGTTCTTGAGTGAGTGGG + Intergenic
1048707846 8:137174333-137174355 ATGGAGGGTTGTTGTTTAGTAGG - Intergenic
1049175132 8:141187712-141187734 ATGGGGGGAAATGATTTAGCAGG - Intronic
1052149349 9:25094593-25094615 ATGGAAGGTCTTGATTTTATCGG + Intergenic
1052282777 9:26752254-26752276 ATGGAGGGTTATTGTTTAATGGG + Intergenic
1055255361 9:74363358-74363380 ATGGAGGGTCATGCTTATATTGG + Intergenic
1058310085 9:103489908-103489930 ATTGAGGGTCAAGCATTAGTTGG - Intergenic
1060024170 9:120157003-120157025 AGGGAGGGTTATCATTTATTTGG + Intergenic
1186464281 X:9772364-9772386 ATGGAGTGTGATGAGTTAGGAGG - Intronic
1189425133 X:40893201-40893223 ATGGAGAGTTATTATTTAATGGG - Intergenic
1189812711 X:44795268-44795290 ATGGAGGGTTGTCATTTAATGGG + Intergenic
1197074334 X:122337109-122337131 ATGCAGGGTCCCTATTTAGTGGG + Intergenic
1197152232 X:123232456-123232478 ATGGGGAGTTATTATTTAGTGGG + Intronic
1201387066 Y:13452740-13452762 ATGGAGGCTCAGGGATTAGTAGG + Intronic