ID: 1130398661

View in Genome Browser
Species Human (GRCh38)
Location 15:83529250-83529272
Sequence GCACCAGTGTTAGCAGATCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 2, 1: 3, 2: 19, 3: 38, 4: 147}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130398657_1130398661 9 Left 1130398657 15:83529218-83529240 CCAGCCATTAGGCTGCTGGGCAG 0: 1
1: 0
2: 6
3: 20
4: 204
Right 1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG 0: 2
1: 3
2: 19
3: 38
4: 147
1130398654_1130398661 18 Left 1130398654 15:83529209-83529231 CCAATTATGCCAGCCATTAGGCT 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG 0: 2
1: 3
2: 19
3: 38
4: 147
1130398658_1130398661 5 Left 1130398658 15:83529222-83529244 CCATTAGGCTGCTGGGCAGTGTA 0: 1
1: 0
2: 0
3: 18
4: 109
Right 1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG 0: 2
1: 3
2: 19
3: 38
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130398661 Original CRISPR GCACCAGTGTTAGCAGATCC AGG Intronic
900586688 1:3435995-3436017 GCAGTTGTGTTTGCAGATCCTGG - Exonic
902511768 1:16970524-16970546 CCACCAGAGGTAGCAGACCCTGG - Intronic
906196531 1:43933707-43933729 GCCCCAGCGTCACCAGATCCCGG - Exonic
906573263 1:46862703-46862725 GCACCAGTGTTGGCTGCTCCAGG - Intergenic
906598613 1:47104391-47104413 GCACCAGTGTTAGCTACTCCAGG + Intronic
908496043 1:64695969-64695991 TCACCAGTGTCAGCAGCTTCAGG + Intergenic
908504321 1:64780703-64780725 GTACCAGTCTTTTCAGATCCAGG + Intronic
909183308 1:72451124-72451146 AAACCAGTGGTAGCAGGTCCAGG - Intergenic
909827486 1:80143606-80143628 GCTCCAGTGTTAGGAGGACCAGG - Intergenic
913057383 1:115175057-115175079 GCCCCAAAGTTAGCAGGTCCTGG - Intergenic
915698987 1:157772925-157772947 GCACCAGTGTGGGCAGAACTAGG - Intronic
915784833 1:158598032-158598054 ACACCTGTGTTAGCAGGTACTGG - Intergenic
917534504 1:175864505-175864527 CCACCAGAGTTGGCAGCTCCTGG + Intergenic
919012396 1:191982773-191982795 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
919590310 1:199493865-199493887 GCACCAGTGTTAGTGGGTCCTGG - Intergenic
922893277 1:229078244-229078266 GGACCAGTGGTGGCAGATCCAGG + Intergenic
1062853081 10:760152-760174 GCACTGGTGGTAGCAGGTCCTGG - Intergenic
1064067577 10:12195820-12195842 GCAGCAGTGTCAGCCGATGCCGG + Exonic
1068157572 10:53222021-53222043 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
1068657711 10:59591899-59591921 GCACAGGTGTTAGCGGGTCCAGG - Intergenic
1068816773 10:61324663-61324685 GCATAAATATTAGCAGATCCAGG - Intergenic
1071666641 10:87564638-87564660 GCACCAGTGTCAGCAAGTCCAGG - Intergenic
1072487114 10:95866161-95866183 TCCCCACTGTTTGCAGATCCAGG + Exonic
1073668134 10:105556467-105556489 GCACCAGTTCTAGCAGATCAGGG + Intergenic
1073986832 10:109219142-109219164 GGACCAGCATTACCAGATCCTGG + Intergenic
1074031964 10:109697674-109697696 ACACCAGTATTAGCAGGACCAGG - Intergenic
1074683537 10:115935132-115935154 GCACAATTGTTAGCAAATCTAGG + Intronic
1077450901 11:2644989-2645011 GTACCAGTGTTAGCAAGTCCAGG + Intronic
1079683806 11:23331665-23331687 ACACCAGTGTTAGTCAATCCAGG + Intergenic
1083736272 11:64683136-64683158 GCCACAGTGTTCTCAGATCCTGG + Intronic
1085493487 11:76945645-76945667 GCACCAGTGTTAGTGGGTACTGG + Intronic
1085542815 11:77288353-77288375 GCACTGGTGTTAGCAGGTCGAGG - Intronic
1085978745 11:81694660-81694682 GCACCAGTGTTATTGGATCCAGG - Intergenic
1088777191 11:113096864-113096886 GCAGCATTGTGAGCAGAACCTGG - Intronic
1095712729 12:45307724-45307746 GCACCAGTGTTTACAGGTCACGG + Intronic
1097079252 12:56417765-56417787 GCACCAGAGTTGGGAGCTCCAGG - Exonic
1098634023 12:72758278-72758300 GCACCAGTGTTAGCATGTCCAGG - Intergenic
1100670223 12:96803437-96803459 GCTCCAGTGTTAGTGAATCCTGG - Intronic
1100776507 12:97980025-97980047 GCACTGGTGTTGGCAGGTCCAGG - Intergenic
1101566159 12:105907595-105907617 CCACCAGTATAAGCAGCTCCGGG - Intergenic
1107467246 13:40662447-40662469 GCACTAGATTTAGAAGATCCCGG + Intronic
1108030554 13:46224983-46225005 GCACCTGTGTTGGCAGTTACTGG + Intronic
1108308793 13:49165609-49165631 GTACCAGTGTTAGCAAATCCAGG + Intronic
1109155614 13:58906024-58906046 GCACCAATGTTAGCACTTCTGGG + Intergenic
1110151263 13:72257379-72257401 GAACCAGTGTTAGGAAATCTAGG - Intergenic
1111176713 13:84605707-84605729 GCACCAGGGTTAGCAGGTCCAGG + Intergenic
1112080121 13:95959817-95959839 GCACCAGTGTTAGCAGGTGCAGG - Intronic
1112821722 13:103345705-103345727 GCACCAGCGTTAGCAGGTCCAGG + Intergenic
1113536950 13:111075891-111075913 GCACTATTGTTAGCAGGTCCAGG + Intergenic
1113764059 13:112869902-112869924 GCCCCAATGTCAGCAGAGCCCGG - Intronic
1114156951 14:20115219-20115241 GCACAAGTGTTTTCAGGTCCTGG + Intergenic
1114400978 14:22410275-22410297 GCACCAGTGGTACCAAATTCTGG - Intergenic
1114836632 14:26210748-26210770 GCCCCAGTGTTTGTATATCCTGG - Intergenic
1115895441 14:38081390-38081412 GCACCATTGTTATCAGATTAGGG + Intergenic
1116418017 14:44701591-44701613 GGACCAGGGTTAGCTGATCTTGG + Intergenic
1122786281 14:104164609-104164631 GCAGCAGGGTTAGCACAGCCAGG + Intronic
1124838275 15:33216757-33216779 GCACCATTTTTAGAAGATCCAGG - Intergenic
1125285390 15:38087413-38087435 GCAGCAGTGTGGCCAGATCCAGG + Intergenic
1126143534 15:45456321-45456343 GCCCCAGTGAGAGCAGAGCCTGG + Intergenic
1126661570 15:51038422-51038444 GCACTGGCGTTAGCAGGTCCAGG + Intergenic
1127410216 15:58697766-58697788 GCACTGGTGTTAGCAGGTCCAGG - Intronic
1129070593 15:72946878-72946900 GCATTGGTGTTAGCAGGTCCAGG - Intergenic
1129377631 15:75144173-75144195 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
1130166088 15:81460753-81460775 GCTCCAGTGTTAGTGGGTCCTGG + Intergenic
1130398661 15:83529250-83529272 GCACCAGTGTTAGCAGATCCAGG + Intronic
1132229957 15:100174269-100174291 GCAATAGTGTTGGCAGATTCTGG + Intronic
1132263934 15:100449464-100449486 GCACTAGTGTTAGCAGCTCCAGG - Intronic
1133439287 16:5807035-5807057 GCACCAGTGATGGCTGAGCCTGG + Intergenic
1138738718 16:59281446-59281468 TCACCAGTGTTATCAGGTCCAGG - Intergenic
1138915314 16:61456111-61456133 GCATCAGTGTTAGTGGGTCCAGG - Intergenic
1138993187 16:62417372-62417394 GCACCAGAGGTAGCAGGTCCAGG + Intergenic
1140735241 16:77892395-77892417 GCAGCAGTGTCTGCAGAGCCAGG - Intronic
1142259063 16:89033939-89033961 TCACCAGTGAGAGCAAATCCCGG - Intergenic
1143632468 17:8147015-8147037 GCACCACAGTGAGCAGAACCAGG + Intronic
1143876561 17:9995666-9995688 TCACCTGTTTTTGCAGATCCTGG - Intronic
1144263442 17:13545592-13545614 ACACCAGTGTTTGCTGATCCTGG + Intronic
1144390085 17:14785047-14785069 GCAGCAGGGTTGGCAGCTCCAGG - Intergenic
1156242811 18:35270001-35270023 CCCACAGTGTTAGCAGATACTGG - Intronic
1156653290 18:39252549-39252571 GCACTGGTGTTAGCAAGTCCAGG - Intergenic
1158002293 18:52633399-52633421 GTGCCATTGTTGGCAGATCCTGG + Intronic
1158735714 18:60076048-60076070 GCACCAGTGTTTACAGGTTCAGG - Intergenic
1159528593 18:69626939-69626961 TCACCAGTCCTTGCAGATCCAGG - Intronic
1161031382 19:2059386-2059408 GTACGAGTGTGAGCAGATCGGGG + Intergenic
1161078949 19:2300871-2300893 GCCCCAGTGTTCACAGAGCCTGG - Intronic
1161696557 19:5771889-5771911 ACACCAGTCTTATCAGATCAGGG + Intronic
1161781923 19:6298562-6298584 GCAGCAGGGTGAGCAGCTCCAGG - Intergenic
1163376139 19:16931638-16931660 GTACCAGTGTTAGTGGGTCCAGG - Intronic
1163655113 19:18541453-18541475 GAGCCACTGTTAGCAGATCTGGG + Intronic
1166903594 19:46087064-46087086 GCATCAGTGTTAGCAGGTCCAGG + Intergenic
928258890 2:29749252-29749274 CCACCAATGTTAGCATTTCCTGG - Intronic
930539111 2:52681634-52681656 GCACCAATGTTAGCAGGTCCAGG - Intergenic
930555749 2:52894149-52894171 GCACCAGTGTTGGTGGACCCAGG + Intergenic
931332138 2:61298654-61298676 GGACCAGTGATAAGAGATCCTGG - Intronic
931551420 2:63450545-63450567 GCACTGGTGTTAGCAGTACCAGG - Intronic
932308620 2:70722036-70722058 ATAACAGGGTTAGCAGATCCTGG + Intronic
934720682 2:96573748-96573770 ACACCACTGTGGGCAGATCCAGG + Intergenic
936785849 2:116094001-116094023 GCACTGGTGTTAGCAGGTCCAGG + Intergenic
936818162 2:116485115-116485137 GCACTGGTGTTAGTGGATCCAGG - Intergenic
937465587 2:122130801-122130823 GTACCAGTGTTAGTTGGTCCAGG + Intergenic
937569239 2:123335142-123335164 GCAAGAGTGCTAGCAGATACAGG - Intergenic
938507370 2:131900481-131900503 GCACCTGTGTTACCAGCTACTGG + Intergenic
939482131 2:142762158-142762180 GTATCAGTGTTAGTACATCCAGG - Intergenic
939531849 2:143373249-143373271 GCACAAGTATTGGCAGAACCAGG + Intronic
940362592 2:152812756-152812778 ACACCAGAGTTAGCGGGTCCTGG + Intergenic
941393493 2:164945842-164945864 GCTGCAGTATTAGCAGAGCCAGG + Intronic
941562962 2:167071806-167071828 CCACCACTGTTACCAGAGCCTGG - Intronic
943714404 2:191134394-191134416 GCACCAGTGTTAGCAAGTCCAGG - Intronic
944048656 2:195440875-195440897 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
944260114 2:197667875-197667897 GCACTGGTGTTAGCAGGTCCAGG + Intronic
945483706 2:210370245-210370267 GCACCAGTGTCAGTGGGTCCAGG + Intergenic
945971152 2:216233580-216233602 GCACCAGTGTGAGCAGGTTCAGG + Intergenic
1169412503 20:5383408-5383430 GCACTGGTGTTAGCATGTCCAGG - Intergenic
1170093439 20:12617730-12617752 GCACCAGTGTTAGCAAGTCCAGG - Intergenic
1172271960 20:33659881-33659903 GCACCTGTGTCAGAAGAGCCGGG + Exonic
1172969803 20:38865119-38865141 GCCCAAGTGTTAGATGATCCTGG + Intronic
1173322485 20:42001010-42001032 GCACCTGTGTTGGCAGTTACTGG + Intergenic
1173576675 20:44116424-44116446 GCACCACTGTTGGGTGATCCTGG + Intronic
1176347381 21:5762057-5762079 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176354195 21:5882641-5882663 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176359393 21:5982526-5982548 GCACCAGTGTTAGTAGGTCCAGG + Intergenic
1176497446 21:7562398-7562420 GCAGCAGTGTTAACAGGTCCAGG + Intergenic
1176541702 21:8160127-8160149 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1176560653 21:8343172-8343194 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1179764125 21:43556024-43556046 GCACCAGTGTTAGTAGGTCCAGG - Intronic
1179922111 21:44512976-44512998 GCACCAGATTTAGCAAATCCAGG + Intronic
1184045929 22:41972099-41972121 GCACCAGTCCTTGCAGAGCCAGG + Intergenic
1185349538 22:50327271-50327293 GCCCCGGTGTTCGCGGATCCCGG + Intergenic
1203246641 22_KI270733v1_random:76546-76568 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
949711757 3:6878905-6878927 GGACCAGTGATAGCAGCACCTGG - Intronic
952653864 3:35760274-35760296 CCACCAGTGTGAGCAGAGACAGG - Intronic
954725107 3:52601693-52601715 GCACTGGTGTTAGCAGGTCCAGG + Intronic
955937366 3:64113960-64113982 GTAACAGTGCTAGCAGATGCAGG - Intronic
957735606 3:84197674-84197696 GCACCAAAGTTAACAGATTCAGG - Intergenic
958640026 3:96794382-96794404 GCACTAGTGTTAGCAGGTCCAGG + Intergenic
960551291 3:118978493-118978515 GTACCAGTGTTAGCGGGTCCAGG - Intronic
960607739 3:119525433-119525455 GCACCAGAGTTAGGAAATCTGGG + Exonic
962592612 3:136906524-136906546 GCACCAGTGTTAGCAGGTTCAGG + Intronic
968932141 4:3586797-3586819 GCAGCAGTGATGGCAGCTCCAGG - Intronic
971732841 4:30407390-30407412 TCACCAGTGTTAGTAGTTTCAGG - Intergenic
972346405 4:38196132-38196154 GTAACAGTGTGAGCAGAACCAGG - Intergenic
976008937 4:80463665-80463687 GTACCAGTCTTATCAGATTCGGG + Intronic
976178854 4:82380645-82380667 GCAGCAGGGTGAGCAGCTCCAGG + Intergenic
980576341 4:134687718-134687740 CCACCAGTGTAAGCACATGCAGG - Intergenic
980610778 4:135160191-135160213 GAACCAGTGTTACCTGATTCAGG + Intergenic
982190908 4:152854893-152854915 GCACCAGTGTTAATGGGTCCAGG + Intronic
983949826 4:173627165-173627187 GCACTGATGTTAGCAGGTCCAGG + Intergenic
985514624 5:335133-335155 GCACCTGTGTTGGCAGTACCAGG + Intronic
985876494 5:2602593-2602615 GCAGCTGTGCTAGCAGTTCCTGG - Intergenic
987009653 5:13749029-13749051 CCAGCAGTGTTAGCAGATTCAGG + Intronic
989231085 5:39086819-39086841 GCACCAGAGTCAGCAGGTCCAGG - Intergenic
989338692 5:40349310-40349332 GCACCTGTGTTGGCAGTTACTGG - Intergenic
989498080 5:42132273-42132295 GCACCCATGATAGCAGGTCCAGG - Intergenic
990752981 5:59038830-59038852 GCACCAGTGACAGCAGAACCGGG + Intronic
992704954 5:79381054-79381076 GCACCAGTGTTAGCAGTTCCAGG - Intronic
994688145 5:102982429-102982451 GTATCAGTGGTAGCAGGTCCAGG - Intronic
997226252 5:132211522-132211544 CCACCGGGGTTAGCAGACCCTGG - Intronic
997782009 5:136668098-136668120 GCACTGGTGTTAGCAGGTCCAGG - Intergenic
1003088636 6:3082177-3082199 GCCCCTGTGTCAGCAGCTCCTGG - Intronic
1011522924 6:88229161-88229183 GCACAAGCCTTAGCAGCTCCAGG + Intergenic
1016247129 6:141995422-141995444 GCACCAGTGTTAGAGGGTGCAGG - Intergenic
1016425816 6:143934882-143934904 GCACTGGTGTTAGCAGGTCCAGG + Intronic
1017964685 6:159253937-159253959 GCACCAGTGGAAGCATATGCAGG + Intronic
1018622856 6:165748522-165748544 ACAGTAGTGTTAGCAGAACCAGG - Intronic
1022985703 7:35651287-35651309 GCACCAGTGTGAGATGGTCCAGG - Intronic
1023232698 7:38051164-38051186 GCACCAGTGTTGGCAGGTCTAGG + Intergenic
1023980434 7:45066703-45066725 GCACCCGTGGTAGCACTTCCTGG + Intronic
1024051547 7:45626960-45626982 GCTCCAATGTGAGCAGATGCAGG + Intronic
1025067995 7:55874448-55874470 ATGCCATTGTTAGCAGATCCAGG + Intergenic
1030208737 7:106975620-106975642 GCACCAGTTCTAACAGATCAGGG - Intergenic
1032901923 7:136320354-136320376 GCACCAGTGTTAGCAGATCCAGG + Intergenic
1033799999 7:144889653-144889675 GCACCAGTTGTATCAGATCAGGG - Intergenic
1035136097 7:156704147-156704169 GCGCCTGTGTTGGCAGTTCCAGG - Intronic
1036826044 8:11977061-11977083 GCACCAGTGTTAGCAGGTCCAGG + Intergenic
1038219310 8:25592522-25592544 GTACCAGTGATAGCAGATCCAGG - Intergenic
1038231236 8:25702458-25702480 GCACCTGTGGTGGAAGATCCAGG - Intergenic
1040360474 8:46659474-46659496 ATACCATTGTTAGCAGATCCAGG - Intergenic
1045337980 8:101225267-101225289 TCACCACTGTTAACAGATCCTGG - Intergenic
1046431513 8:114134676-114134698 GCACCAGTGTTAGAAAGTCTAGG + Intergenic
1048176419 8:132156636-132156658 GAACCTGTCTCAGCAGATCCAGG - Intronic
1048331538 8:133473999-133474021 GCACCACTGTGTGCAGGTCCTGG - Intronic
1048474146 8:134728079-134728101 GCACCACTGGTAGTATATCCAGG - Intergenic
1049010440 8:139883816-139883838 GCTCCAGAGTGAGCAGAGCCGGG - Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1050242942 9:3658014-3658036 TCACCAGTGTCAGCAGGTCCAGG + Intergenic
1051593008 9:18795434-18795456 GCACCAGTGGAAGCAGATGTGGG + Exonic
1054457994 9:65445131-65445153 GCAGCAGTGATGGCAGCTCCAGG + Intergenic
1055662693 9:78520612-78520634 GCAACAGTGTTAGCAGGTTCAGG - Intergenic
1058129337 9:101232284-101232306 GAACCAGTTTTTGCAGAACCAGG - Intronic
1058235429 9:102485033-102485055 CCCCCAGCTTTAGCAGATCCAGG + Intergenic
1058937468 9:109782138-109782160 ACCCCAGTGTTAGCAGCTACTGG - Intronic
1203462975 Un_GL000220v1:59608-59630 GCAGCAGTGTTAACAGGTCCAGG - Intergenic
1188739694 X:33763545-33763567 GCACCATTGCTAGCAGATCCAGG + Intergenic
1188757850 X:33986908-33986930 GCACCAGTGTTAGTGGATCCAGG + Intergenic
1190058786 X:47197765-47197787 GCTTCAGAGTCAGCAGATCCTGG + Intronic
1190925027 X:54895040-54895062 GCCCTGGTGTTAGCAGGTCCAGG - Intergenic
1191611737 X:63122532-63122554 GCAGCAGTGTTATCAGGTCTAGG - Intergenic
1192079554 X:68033453-68033475 GCGTTAGTGTTAGCAAATCCAGG - Intergenic
1192926614 X:75760411-75760433 GCAAGAGTGTTAGCAAATACAGG - Intergenic
1193442310 X:81557281-81557303 ACACCAGTGTTAGCTAATCTAGG - Intergenic
1196574906 X:117305717-117305739 GCACTAGTGTTAGTGGGTCCAGG - Intergenic
1197309192 X:124883504-124883526 GCACCAGTCTTAGTGGGTCCAGG + Intronic
1197521026 X:127495905-127495927 GCACTGGTGTCAGCAGGTCCTGG - Intergenic
1197548861 X:127862479-127862501 GCACCATTGTTAGCAGGTCCAGG - Intergenic
1197643412 X:128992366-128992388 GAATCAGTGTTAGAAGGTCCAGG + Intergenic
1197710534 X:129663551-129663573 GCACCTTTGTTTGCAGAGCCAGG + Intergenic
1198299113 X:135317408-135317430 GCACCATTGTTAGCAGGTCCAGG + Intronic
1198623056 X:138534802-138534824 GCACCTGTATTAGCAGTTACTGG - Intergenic
1201766275 Y:17576231-17576253 ACACCAGCCTTGGCAGATCCTGG - Intergenic
1201835277 Y:18329758-18329780 ACACCAGCCTTGGCAGATCCTGG + Intergenic