ID: 1130398828

View in Genome Browser
Species Human (GRCh38)
Location 15:83530077-83530099
Sequence GGGTTGTTAGTGGTGCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130398824_1130398828 -10 Left 1130398824 15:83530064-83530086 CCTCCAGTGTAGGGGGTTGTTAG 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG 0: 1
1: 0
2: 2
3: 11
4: 127
1130398819_1130398828 11 Left 1130398819 15:83530043-83530065 CCAGCATCATGCTACTGCAGTCC 0: 1
1: 0
2: 40
3: 1684
4: 27388
Right 1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG 0: 1
1: 0
2: 2
3: 11
4: 127
1130398818_1130398828 15 Left 1130398818 15:83530039-83530061 CCAGCCAGCATCATGCTACTGCA 0: 1
1: 0
2: 2
3: 25
4: 209
Right 1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG 0: 1
1: 0
2: 2
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130398828 Original CRISPR GGGTTGTTAGTGGTGCTTCA GGG Intronic
902071077 1:13738535-13738557 GGTCTGTTAGTGCGGCTTCAAGG + Intronic
902182829 1:14702534-14702556 GGATTGTGAGTGGGGTTTCATGG - Intronic
903228081 1:21905018-21905040 TGGTTGTTAGTGGTGTCTCATGG - Intronic
907363992 1:53945347-53945369 GGGCTGGTAGTGGCGCTTCCAGG + Intronic
909405397 1:75282605-75282627 GTGTTGGGAGTGGAGCTTCATGG + Intronic
913030082 1:114892808-114892830 GGGATGTCAGTGGGGCTCCAGGG + Intronic
913289953 1:117262816-117262838 GGGCTGATGGTGGAGCTTCAGGG - Intergenic
916946929 1:169738444-169738466 GGCTGATTAGAGGTGCTTCAAGG + Intronic
917552832 1:176053387-176053409 GGGTTGGTAGAGGAGCATCAAGG - Intronic
919043631 1:192424358-192424380 TGGATGTCAGTGGGGCTTCAGGG - Intergenic
921616125 1:217270054-217270076 GGGATGTTAGGGGAGCATCATGG - Intergenic
924467950 1:244315137-244315159 GTGTTGCTAGTGGGGCTTCTGGG - Intergenic
924640777 1:245831496-245831518 AAGTTGTTAGTGGTTCTTCTGGG - Intronic
1062863908 10:833378-833400 TGTTTTTTAGTGGTGCTTTAGGG - Intronic
1063019752 10:2115995-2116017 AGGTTGTTATTTCTGCTTCATGG - Intergenic
1065995115 10:31052246-31052268 GTGCTGATAGAGGTGCTTCACGG - Intergenic
1067906236 10:50294387-50294409 GGGATGTCAGTGGGGCTCCAGGG - Intergenic
1069092858 10:64223346-64223368 GGGATGTTAGTGCAGCTCCAGGG - Intergenic
1073039010 10:100586732-100586754 GGGTTTTTAGTGGTACTTAGTGG - Intergenic
1073647970 10:105326072-105326094 GTGTTGTTATTGGTGGTTTAAGG - Intergenic
1077785916 11:5383402-5383424 GTGGTGATTGTGGTGCTTCAAGG + Intronic
1085978614 11:81693878-81693900 GGGTTGTCAGTGGAGCTCCAGGG - Intergenic
1087124239 11:94607302-94607324 GGCATGTTAGTGTTGCTTCTTGG + Intronic
1087718126 11:101632498-101632520 GGGATGTTGGTGGGGCTCCAGGG - Intronic
1089539941 11:119183726-119183748 AGGTTGGTAGTGGTGCTTCAGGG - Exonic
1094415729 12:30212924-30212946 GGTCTGGTGGTGGTGCTTCAGGG + Intergenic
1094473428 12:30823605-30823627 GGGTTGTGAGGGGTGCTTGTAGG + Intergenic
1095212426 12:39509787-39509809 GGGATGTCAGTGGGGCTCCAAGG - Intergenic
1097566426 12:61275196-61275218 GGGTTGTTCTTGCTGTTTCAGGG - Intergenic
1098499027 12:71168906-71168928 GGGTTGTTTGTGCAGCCTCATGG + Intronic
1101466396 12:104954483-104954505 GGGTTTTTAGTGGCGCTTATTGG - Intronic
1104588634 12:130067084-130067106 GGGTTGTTAGTGGGGCCTGGTGG + Intergenic
1108927972 13:55777282-55777304 GGGTTGTCAGTGGGTCTTCAGGG - Intergenic
1108988303 13:56622716-56622738 GGGATGTCAGTGGGGCTCCAGGG - Intergenic
1110350924 13:74506365-74506387 TGTTTGTTAGTTGAGCTTCAGGG + Intergenic
1112492998 13:99883916-99883938 ATGATGTTTGTGGTGCTTCAGGG - Intronic
1118490900 14:66258519-66258541 GGGTTGTGAGTGATGCGTCCGGG + Intergenic
1120401661 14:84040252-84040274 TGGTTGTTAGTGGTGCAACCAGG + Intergenic
1120860112 14:89247365-89247387 GGGTTGCTAGTGGAGCTTTCTGG + Intronic
1121174185 14:91878411-91878433 GGGGTGTTAGGGGTGAATCAAGG - Intronic
1121784878 14:96649849-96649871 GGGATGTCAGTGGGGCTCCAGGG + Intergenic
1122069681 14:99197546-99197568 GGGTGGTGAGGGGTGCTCCAGGG + Intronic
1124597123 15:31100845-31100867 GGGTTGTTTGCTGTGCTTCCCGG + Intronic
1124862019 15:33450988-33451010 GGGTTGTTTCAGGTGCTGCAAGG - Intronic
1127578830 15:60318046-60318068 GGGTTTTAACTGGTGCTCCAAGG + Intergenic
1128632680 15:69281964-69281986 GGGTTATCAGGGATGCTTCATGG - Intergenic
1129030774 15:72616094-72616116 GGGGTGATATTGGTGTTTCAAGG + Intergenic
1129477617 15:75796618-75796640 GGGGTGATATTGGTGTTTCAAGG + Intergenic
1130398828 15:83530077-83530099 GGGTTGTTAGTGGTGCTTCAGGG + Intronic
1140399494 16:74659285-74659307 GAGTTGTGAGTGGTGTTTCCAGG - Intronic
1142499247 17:323205-323227 GGGTGGTGTGTGGTGTTTCAGGG + Intronic
1144341220 17:14311849-14311871 CTGTTTTAAGTGGTGCTTCAAGG - Intronic
1147631769 17:41936790-41936812 GGGGTGTAAGAGGTGTTTCATGG - Exonic
1148188803 17:45664628-45664650 GGGTTGTGAATGGTCCTGCATGG - Intergenic
1150235529 17:63589956-63589978 GGCTGGACAGTGGTGCTTCAGGG - Exonic
1151521921 17:74636387-74636409 GGCTTGCAAGTGGGGCTTCATGG - Intergenic
1151847605 17:76668244-76668266 GGTTTGTTAGGGGTGCTCCCAGG - Intergenic
1154948416 18:21184743-21184765 TGGTTGTGAGTGCTGGTTCAGGG - Intergenic
1155216426 18:23647506-23647528 GGCTTCTTAGTGGTGCTCTATGG + Intronic
1155799452 18:30082126-30082148 AGGATGTTAATGGTGCTTCAGGG + Intergenic
1164005290 19:21142660-21142682 GGTTTGTAATTTGTGCTTCATGG + Intronic
928448342 2:31353407-31353429 GAGTTTTTAGTGGTACTTAATGG - Intronic
928671606 2:33608908-33608930 GGGGTGGTAGGGGTGCTTCCAGG - Intergenic
931627528 2:64270534-64270556 GGGCTGTGAGTGGTGTTTCTTGG + Intergenic
936168471 2:110145775-110145797 GGGTTTTTAGTTGTGCTTAGTGG - Intronic
939388762 2:141538406-141538428 GGCTTTTTAGTGGTGATTCCAGG - Intronic
946782386 2:223205140-223205162 GGGATGTCAGAGGGGCTTCATGG - Intergenic
947586801 2:231361563-231361585 GGGTTATTAGGGGTTCTTTAGGG + Intronic
1179190946 21:39121312-39121334 GGGATGTCAGTGGGGCTCCAGGG - Intergenic
1179598458 21:42459691-42459713 TGGTAGTTATTGGTGCTGCATGG - Intergenic
1180051566 21:45333860-45333882 GGGTTGTCAGAGGGGCCTCACGG - Intergenic
952543731 3:34396123-34396145 AGGATGTTAGTGGGGCTCCAGGG + Intergenic
956961716 3:74410521-74410543 GGGATGTTAGTGGTGCTTAAAGG + Intronic
957448007 3:80339489-80339511 GGGATGTCAGTGGTGCTCCAGGG + Intergenic
957494191 3:80969523-80969545 GGGATGTTAGTGGGGCTCCAGGG + Intergenic
957994739 3:87674751-87674773 GGCTTGTAAGTGGAGCTTCAGGG - Intergenic
958960870 3:100508374-100508396 GGGATGTCAGTGGGGCTCCAGGG - Intronic
958969972 3:100600813-100600835 GGGCTGTTTGTGGGGGTTCATGG - Intergenic
960204885 3:114884880-114884902 GGTTTGTTAGAGGAGCTACAGGG - Intronic
961558540 3:127713198-127713220 GAGGTGTTTGTGGTGTTTCATGG - Intronic
964475052 3:157090568-157090590 GGGTTCTTTGTGCAGCTTCATGG + Intergenic
967460812 3:189744099-189744121 GGAATGTCAATGGTGCTTCAAGG - Intronic
969179215 4:5424331-5424353 GGCTTGAAAGTGGGGCTTCATGG - Intronic
972584430 4:40424003-40424025 GGAATGTTAGCGGTGCTTAAAGG + Exonic
979413340 4:120406125-120406147 GGGTTGGCATTGGTGATTCAGGG - Intergenic
981421916 4:144560649-144560671 GGGTTGTTCTTGCTGCCTCAGGG + Intergenic
990748077 5:58981778-58981800 GGGTTATTAGTGGTCCTGCCTGG + Intronic
990834300 5:59998730-59998752 TGGTTGTTATTGTGGCTTCATGG - Intronic
992435772 5:76754945-76754967 GGGTTATTAGTGCTGCTCCCAGG - Intergenic
993377021 5:87160607-87160629 GGGTTCTTAATGATGTTTCATGG - Intergenic
995012066 5:107267537-107267559 GGGTTGTAAATGGCACTTCAAGG - Intergenic
995956679 5:117784950-117784972 GGGTTGTTTGTTGTTGTTCATGG + Intergenic
996912833 5:128675077-128675099 AGGTCGTTAGTGGGGCTCCATGG + Intronic
997383794 5:133456725-133456747 GGTGTGTTACTTGTGCTTCAGGG - Intronic
997548357 5:134730317-134730339 GGGCTCTTAGTGGTGCTTCTGGG + Intergenic
998346084 5:141465020-141465042 GGGTCATTTGTGGTGGTTCATGG - Intronic
998557732 5:143141991-143142013 GGGTTATTACAGGTGCTGCAGGG + Intronic
999315877 5:150583705-150583727 AGGTGGTTAGTGGTACTGCAAGG + Intergenic
1003466114 6:6381648-6381670 TGGTTGCTGGTGTTGCTTCAAGG + Intergenic
1003934613 6:10962482-10962504 TGGTAGTTAGTGGTTCTCCAAGG + Intronic
1004680296 6:17887340-17887362 AGGTTGTTACTGTTGCATCACGG + Intronic
1005899609 6:30206158-30206180 GGTTTGTTAGAGGTGTCTCACGG - Intronic
1006151483 6:31992432-31992454 GGTTTCTAAGTGGAGCTTCACGG - Exonic
1006157784 6:32025170-32025192 GGTTTCTAAGTGGAGCTTCACGG - Exonic
1007728751 6:43933011-43933033 GGGTGGGCAGTGGTGGTTCATGG + Intergenic
1012763622 6:103334723-103334745 GGGTTATTAGTGGTTGTTCTAGG - Intergenic
1014152609 6:118075695-118075717 GAGTTGATTGTGGTGCTTAATGG + Intronic
1015307522 6:131726351-131726373 AGGTTGTTATAGGTGCTACACGG + Intronic
1019178294 6:170172029-170172051 GGGTTGTTAGTGTCTGTTCAGGG + Intergenic
1019178339 6:170172290-170172312 GGGTTGTTAGTGTCTGTTCAGGG + Intergenic
1019194777 6:170274750-170274772 GGGTTGTGGGTGCTGCTTCCTGG + Intergenic
1020854482 7:13400324-13400346 GTGTTGTTTCTGGTGCTGCATGG - Intergenic
1022361997 7:29669794-29669816 GGGTTTTCAGTTGTACTTCAAGG - Intergenic
1022699397 7:32743941-32743963 GGGTTTTCAGTTGTACTTCAAGG + Intergenic
1023002461 7:35824378-35824400 GGGATGTTGGTGTTGCTTCTTGG + Intronic
1024602671 7:50998253-50998275 TAGGTGTTAGTGATGCTTCAAGG - Intergenic
1026890657 7:73979889-73979911 GGTTTGTTATAGGTCCTTCAGGG - Intergenic
1030219455 7:107081824-107081846 GTGTTGTTAGACGTGTTTCAAGG + Intronic
1030687734 7:112504148-112504170 GGGATGTCAGTGGGGCTGCAGGG + Intergenic
1032145445 7:129375701-129375723 GGGTTGTTGGAGCTGCTTCAGGG + Intronic
1033761238 7:144438791-144438813 GGGTTGTCACTGGTTCTTCCAGG - Intergenic
1033839419 7:145356239-145356261 GGGTTGATCTTGCTGCTTCAGGG - Intergenic
1037905081 8:22711497-22711519 GGGGTGTTAGGGGTGCTGAAAGG + Intergenic
1040360281 8:46658512-46658534 GGGATGTCAGTGGGGCTCCAGGG - Intergenic
1042649572 8:71024428-71024450 GGGATGTCATTGGGGCTTCAAGG + Intergenic
1043116007 8:76254889-76254911 GGATTGTCAGTGGGGCTGCATGG - Intergenic
1043226215 8:77734436-77734458 GTATTGTTAGTGGTTCTTCAGGG + Intergenic
1045397454 8:101775139-101775161 GAGTTGTTAGTGATGCTATATGG + Intronic
1049401969 8:142432123-142432145 GTGGTGGTGGTGGTGCTTCAGGG - Intergenic
1051507773 9:17844558-17844580 GGGTGGTGGGTGGTGCTGCAGGG + Intergenic
1051723651 9:20065951-20065973 TGATTGTTAGTGAAGCTTCAAGG - Intergenic
1058074738 9:100638837-100638859 GGGTTTTTAGTTGTGCTTAGTGG + Intergenic
1059330124 9:113529654-113529676 GGGTCGTTGGTGGTACTTCCTGG - Intronic
1187855967 X:23636605-23636627 GGGATGTTAGTGGGGCTCCAGGG - Intergenic
1194552468 X:95319241-95319263 GGGTTGTCAGCTGTGATTCAAGG - Intergenic
1195174993 X:102306146-102306168 GGGTTGGTAGTGGGGCGGCAGGG + Intergenic
1195183872 X:102380947-102380969 GGGTTGGTAGTGGGGCGGCAGGG - Intronic
1196310760 X:114162407-114162429 GGGATGTCAGTGGGGCTCCAGGG + Intergenic
1199148162 X:144396610-144396632 GGGATGATGTTGGTGCTTCAAGG - Intergenic
1199629179 X:149764203-149764225 GGGGTGAGAGTGGGGCTTCAGGG - Intergenic
1201471109 Y:14335931-14335953 GAGTTGCTACTGGTGCCTCAGGG + Intergenic