ID: 1130399348

View in Genome Browser
Species Human (GRCh38)
Location 15:83534674-83534696
Sequence AGTCTGAGGGGAACAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130399348 Original CRISPR AGTCTGAGGGGAACAGAAGT AGG (reversed) Intronic
901940374 1:12657253-12657275 AGACTGAGGGAAACAGCAGCAGG + Intronic
902596140 1:17510658-17510680 GCTCTGAGGGGAAGAGAATTTGG - Intergenic
902596150 1:17510704-17510726 GGTCTAGGTGGAACAGAAGTGGG - Intergenic
902816525 1:18919471-18919493 AGACCGAGGGAAGCAGAAGTGGG + Intronic
902830899 1:19011912-19011934 AGTCTGAGGTGAGCAGGGGTGGG + Intergenic
903641661 1:24864157-24864179 GTTCTGAGGAGAACAGAGGTGGG - Intergenic
904037465 1:27566635-27566657 AGTGTGGGGGGAACAGCAGTAGG + Intronic
905147339 1:35897435-35897457 TGTGTGAGGGGAAAAGCAGTAGG + Intronic
906501266 1:46343014-46343036 AGGCAGAGGGGAAAAGAAGTGGG - Intronic
906825235 1:48972214-48972236 GGACTGAGGGCAACAGAGGTAGG + Intronic
907218554 1:52887278-52887300 TGTCTGTGGGGAATACAAGTAGG - Intronic
909523169 1:76592629-76592651 AGTCTGAGGTGAAGAGGAGTGGG - Intronic
910267985 1:85360724-85360746 AGTTAGAGGAGAATAGAAGTAGG + Intronic
911220820 1:95243431-95243453 AGGCTGAGTAGAACAGAACTGGG - Intronic
911409066 1:97478929-97478951 AGTTTGAAGCCAACAGAAGTTGG - Intronic
911591291 1:99751139-99751161 TGTCTGAGGGCAAGAGAAGAGGG - Intronic
911977090 1:104512098-104512120 AGTTTGGGGGAAAGAGAAGTAGG + Intergenic
912393195 1:109319152-109319174 AAGCTAAGAGGAACAGAAGTGGG - Intronic
913393311 1:118338715-118338737 AATCTGTGTGGCACAGAAGTGGG + Intergenic
914048214 1:144107858-144107880 AGAATGAGAGGAACTGAAGTCGG - Intergenic
914130970 1:144857590-144857612 AGAATGAGAGGAACTGAAGTCGG + Intergenic
915374763 1:155383760-155383782 AGGCTGAGGGGAACAGAGAATGG + Intronic
915641443 1:157230240-157230262 AGCCTGAGGAGAACAGCAGGAGG + Intergenic
915667238 1:157456254-157456276 AGCCTGAGGAGAACAGCAGGAGG - Intergenic
916017834 1:160765834-160765856 TGTCTGAGGGGAGGAGAAGATGG + Intergenic
916651084 1:166835394-166835416 TGTCTGAGGGCAAGAGAAGATGG - Intergenic
916778767 1:167999661-167999683 AGTCTGAAGCTAACAGAGGTTGG - Intronic
917220157 1:172720122-172720144 AATCTGAGGGGAACATAAATTGG + Intergenic
917247659 1:173022171-173022193 TGTCTGAGGGCAAGAGAAGATGG + Intergenic
917585849 1:176425820-176425842 AGTCTGCAGGGACCAGAGGTTGG - Intergenic
917798328 1:178548132-178548154 AGCCTGGTGGGAAGAGAAGTGGG + Intronic
918434494 1:184497335-184497357 TCTCTGAGGGGAAAATAAGTTGG + Intronic
920497260 1:206464002-206464024 AGTCTTCGGGGAAGAGAGGTGGG + Exonic
921213621 1:212919901-212919923 AGCCTGAGGGCATCAGATGTAGG + Intergenic
921459012 1:215406901-215406923 AGTGGGATGGGAACAGAGGTGGG + Intergenic
921569674 1:216763480-216763502 AGTGTGAGGGGAAAAAAAGAGGG + Intronic
923937866 1:238784347-238784369 AGCCAGAGGGAAACAGAAGTTGG + Intergenic
924371856 1:243359490-243359512 AGTCTGGAGGGAACAAGAGTGGG + Intronic
924948168 1:248859502-248859524 ATTCTGATGGTAATAGAAGTGGG - Intergenic
1062957346 10:1549058-1549080 CGTCTGAGGGGAACTGCAGCCGG + Intronic
1064782884 10:18862193-18862215 TGTCTGAGGGCAAGAGAAGATGG + Intergenic
1065386411 10:25138066-25138088 AGTCTAAGGGCAATAGAAGATGG + Intergenic
1068414925 10:56708235-56708257 ACTCTGAGAGGCTCAGAAGTAGG - Intergenic
1071057915 10:81532112-81532134 AGTTTGAAGTGAACAGAAGCTGG - Intergenic
1071276407 10:84059602-84059624 AGTCAGGGAGGAACAGAAGTTGG + Intergenic
1071906311 10:90177993-90178015 AGTCTGAGGGGAACAGACCCAGG + Intergenic
1072293760 10:93990764-93990786 GGTGTTAGGGGAACAGAATTTGG - Intergenic
1073309730 10:102531778-102531800 AGGCTGAAGGGACCAGAAGAGGG + Intronic
1073694807 10:105852867-105852889 AGACTGAGGGTAAAAGAAATGGG + Intergenic
1074161986 10:110843092-110843114 AGTCTGAGGGCAAGAGAGGAAGG + Intergenic
1074506856 10:114078776-114078798 AGTCAGAGGAGAGCAGAAGTAGG - Intergenic
1074860789 10:117508662-117508684 AGTCTGATTGGAAAGGAAGTGGG + Intergenic
1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG + Intronic
1076755971 10:132571957-132571979 AGACAGAGGGGCACAGCAGTGGG - Intronic
1078578251 11:12518990-12519012 AGTCTGAGGGGAAATGCAGAAGG + Intronic
1079837418 11:25351254-25351276 AGCCTGAGGGCAGCAGAAGCTGG + Intergenic
1080859685 11:36142520-36142542 AGTCTGAGTGGAAGAGGATTCGG + Intronic
1082286530 11:50323723-50323745 AGTCTGGGGAGAACACATGTAGG - Intergenic
1082313926 11:50694489-50694511 AGTGTGAGGGGTGCAGAAGTCGG + Intergenic
1083417794 11:62536519-62536541 AGACTGAGGGGAAGAGAGGAAGG - Exonic
1083826461 11:65206730-65206752 AGTCAGAGGGGGACAGCAGAGGG - Intronic
1084432424 11:69118697-69118719 AGTCTAAAGGGAAAGGAAGTAGG - Intergenic
1086816975 11:91383938-91383960 AGTCAGAGGAGAAAAGAATTAGG + Intergenic
1086817117 11:91385846-91385868 AGTCAGAGGAGAAAAGAATTAGG + Intergenic
1087987153 11:104696820-104696842 AGTATGAGGGGACTAGTAGTTGG - Intergenic
1088347608 11:108845956-108845978 AGTATGAGGGAAAAACAAGTAGG - Intronic
1088543958 11:110941245-110941267 AGTCTGAGGGTACTAGAAGTAGG + Intergenic
1088553502 11:111038122-111038144 GGTGTGAGGTGAACAGAGGTAGG + Intergenic
1089920789 11:122207591-122207613 AGCTTGAGTGGAACAGCAGTGGG - Intergenic
1090412106 11:126516370-126516392 AGGATGGGGGGATCAGAAGTGGG - Intronic
1091546218 12:1503049-1503071 AGTGTGAGGAGAGCAGAAGCAGG - Intergenic
1091835476 12:3582811-3582833 AACCTGAGGGGAGCAGAATTCGG - Intronic
1092252345 12:6906704-6906726 AGCCTGAGGCCAACAGAAGTGGG + Intronic
1095791182 12:46169128-46169150 AGTCTGAAGGTATCAGAGGTTGG - Intergenic
1095805882 12:46320996-46321018 AGTCCCAGGGTATCAGAAGTGGG - Intergenic
1097242331 12:57583999-57584021 AGTCTGAGAAGCAGAGAAGTAGG + Intronic
1097681858 12:62656725-62656747 AGTGTGAGGGGAACAGGAGGAGG + Intronic
1098768061 12:74514888-74514910 AATGTGAGGGGAACTGAAGTGGG + Intergenic
1099263819 12:80418372-80418394 AGTATGAGGTGAACTGAACTAGG - Intronic
1099424072 12:82501446-82501468 AGGCTGAGGGGAAGAGAAAGGGG - Intergenic
1101503374 12:105325160-105325182 AGTGGGAGGGGATCAGGAGTAGG - Intronic
1103045669 12:117732748-117732770 AGCCTAAGGGGAACAGGAGGAGG + Intronic
1104470983 12:129029400-129029422 AGTGTGAGGGGAACAGACCCTGG + Intergenic
1104664107 12:130635254-130635276 AGTCTAATGGGGACAGAGGTAGG - Intronic
1104978737 12:132563395-132563417 AGGCTGTGGGGACCAGATGTGGG - Intronic
1105507272 13:21021036-21021058 AGTCTGAGAGGAAGAGAGGTGGG + Intronic
1105753564 13:23444333-23444355 AGTCTGAAGGCATCAGAATTAGG - Intergenic
1107722596 13:43264403-43264425 AGTTCTAGGGGAACAGAAATGGG - Intronic
1114073061 14:19131245-19131267 AGATTGAGGGGCACAGAACTAGG - Intergenic
1114089205 14:19268749-19268771 AGATTGAGGGGCACAGAACTAGG + Intergenic
1114278544 14:21169494-21169516 AGTCTGTGGGGACCAGAGGCTGG + Intergenic
1117022531 14:51586236-51586258 AGTCTAAAAGCAACAGAAGTTGG - Intronic
1117650416 14:57899290-57899312 AGTCTGAGGTTCAGAGAAGTTGG + Intronic
1118807685 14:69251889-69251911 AGTTTGAGGGGAGCATGAGTAGG - Intergenic
1120524223 14:85559211-85559233 AGTCTGATGGGGACAGACTTGGG + Intronic
1121527866 14:94632125-94632147 GGTCTGAGTGGGACAGATGTTGG + Intergenic
1122685513 14:103503436-103503458 ACTCTCAGGGTAACGGAAGTAGG - Exonic
1123418146 15:20107451-20107473 AGAATGAGAGGAACTGAAGTCGG - Intergenic
1123527364 15:21113973-21113995 AGAATGAGAGGAACTGAAGTCGG - Intergenic
1124255435 15:28138109-28138131 AGTCTGAAGGTAACAGAGATTGG + Intronic
1124950376 15:34313459-34313481 AGTTTGAAGCTAACAGAAGTTGG + Intronic
1125319825 15:38474045-38474067 AGTCTCATGGGAACAGAAAATGG + Intronic
1125361522 15:38869588-38869610 AGTCAGAGAGGAAGAGAACTTGG - Intergenic
1126681156 15:51203215-51203237 AGGCTGAGGGGAACTGCAGAAGG + Intergenic
1128092772 15:64930367-64930389 AGTCTCAGGAGGACAGAGGTGGG + Intronic
1129695381 15:77738044-77738066 AGGCTGAGGGAAACATAATTTGG - Intronic
1130399348 15:83534674-83534696 AGTCTGAGGGGAACAGAAGTAGG - Intronic
1132643788 16:989688-989710 AGGCTGTGGGGAGCAGAGGTGGG - Intergenic
1133848432 16:9478927-9478949 AGGTTGAGAGGAAGAGAAGTGGG - Intergenic
1134098506 16:11435546-11435568 GGTCTCAGGGGAACAGAAGAGGG + Intronic
1135468657 16:22709531-22709553 AGTCTGAGAGGGCCAGAACTGGG - Intergenic
1136171892 16:28494829-28494851 AGTTTGAGGAGATCAGAAGGAGG - Intronic
1136279890 16:29202136-29202158 TGTCTGAGGGGTACTGAACTTGG + Intergenic
1136385858 16:29925728-29925750 AGACTGCGGGGAACGGGAGTTGG + Intronic
1139761033 16:69185143-69185165 AGTCTGAGGGCAGGAGAAGATGG - Intronic
1140086706 16:71803524-71803546 AGTTTGAAGGGTCCAGAAGTGGG - Intronic
1140527336 16:75633912-75633934 AGTTTTAGGGGAACCAAAGTAGG + Intronic
1141173213 16:81704162-81704184 AGGCTGAGGGGAAAGGAAGATGG - Intronic
1142084282 16:88168244-88168266 TGTCTGAGGGGTACTGAACTTGG + Intergenic
1142830476 17:2545421-2545443 AGCCTGATGGGAAGAGAAGAGGG - Intergenic
1143255450 17:5554240-5554262 AGCCTGAGGGGAAGAGATGACGG + Intronic
1143280458 17:5750451-5750473 AGTCTGGGGAGTAAAGAAGTTGG - Intergenic
1143572842 17:7771310-7771332 ATTCTGAGGGGGCCAAAAGTTGG - Exonic
1143993199 17:10984634-10984656 AGTCAGAGGGGACCTGCAGTTGG + Intergenic
1146158664 17:30546982-30547004 AGTTTTGGGGGCACAGAAGTCGG + Intergenic
1146951972 17:36913022-36913044 AGTCTGAGGGGAGGAGAAGATGG - Intergenic
1148152549 17:45405104-45405126 GGGCTGCGGGGAACAGAAGGTGG + Exonic
1148205787 17:45779012-45779034 GGTCTGATGGGAACAGGAGATGG - Intergenic
1148721385 17:49755776-49755798 AGTATGTGGGGACCAGAAGTGGG + Intronic
1149127482 17:53253955-53253977 AGTCTGAAGGGTGAAGAAGTAGG + Intergenic
1149527614 17:57368958-57368980 AGTCTGTGGGGGTCAGAAATAGG + Intronic
1149642290 17:58211020-58211042 AGTCTAAGGTGAAGAGAAGTGGG + Exonic
1151076573 17:71280183-71280205 AGGCTGAGGGAATCCGAAGTAGG + Intergenic
1151406855 17:73893419-73893441 AGTCAGAGAGGAAAACAAGTAGG + Intergenic
1151739624 17:75971386-75971408 GGTTTGAGGCAAACAGAAGTTGG - Intronic
1152526511 17:80891055-80891077 AGTCACTGGGGAACAGAAGGGGG - Intronic
1203160475 17_GL000205v2_random:44628-44650 AGCCTGAGGGAAGCAGAAGATGG + Intergenic
1159434659 18:68400184-68400206 AGTCTAGAGGGGACAGAAGTGGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1163619096 19:18347589-18347611 AGTCAGAGAGAAACAGAAATGGG - Intronic
1164461618 19:28453917-28453939 AGCCTGAGGGGAAGAGGAGCTGG + Intergenic
1165168461 19:33873127-33873149 TTTCTGAGGGGAAAAGAATTTGG - Intergenic
1165760306 19:38317216-38317238 AGTCTGAGAGGGAGAGAAGGGGG - Intronic
1167019524 19:46863014-46863036 AGTCCAAGAGGAACAGAATTGGG - Intergenic
1202687666 1_KI270712v1_random:60753-60775 AGAATGAGAGGAACTGAAGTCGG - Intergenic
925430939 2:3792361-3792383 AACCTGAGGCCAACAGAAGTAGG - Intronic
926471216 2:13260536-13260558 AGTTGAAGGGGAACAAAAGTTGG + Intergenic
927438722 2:23093537-23093559 AGGGTGGGGGGAAAAGAAGTTGG + Intergenic
928716089 2:34062630-34062652 AGTCCGACAGTAACAGAAGTTGG - Intergenic
929312230 2:40438707-40438729 ATTCTTAGGTGAACTGAAGTTGG - Intronic
930068466 2:47346005-47346027 AATCAGAGAGGAACAGAAGCAGG - Intronic
930272609 2:49274425-49274447 TGTCTGAGGGTAGCAGAAGATGG - Intergenic
930684795 2:54296370-54296392 ACTCTGAGGGGACCAATAGTTGG + Intronic
931472185 2:62549395-62549417 AGTGTGAAGGCAATAGAAGTGGG - Intergenic
931805575 2:65800537-65800559 AAGCTGAGGGGCACAGAAGCCGG - Intergenic
931859320 2:66337595-66337617 AGCCTGAAGAGAAAAGAAGTTGG - Intergenic
933958688 2:87394832-87394854 AGAATGAGAGGAACTGAAGTCGG + Intergenic
934110808 2:88740478-88740500 AGTATCAGGAGAATAGAAGTAGG + Intronic
934242818 2:90286838-90286860 AGAATGAGAGGAACTGAAGTCGG + Intergenic
934270358 2:91529845-91529867 AGAATGAGAGGAACTGAAGTCGG - Intergenic
936510103 2:113138257-113138279 ATTCTGGGGGGAACATAAATTGG + Intergenic
936783533 2:116063997-116064019 AATCTCTGGGGAACAGAAGGTGG + Intergenic
937071852 2:119069757-119069779 AGTCTGAGAGGGACAAAGGTAGG - Intergenic
938487118 2:131723026-131723048 AGATTGAGGGGCACAGAACTAGG - Intronic
938960666 2:136337865-136337887 AGTCTGAAGATAACAGAGGTTGG + Intergenic
939570597 2:143836144-143836166 TGTCTGAGGGCAAGAGAAGATGG - Intergenic
939834047 2:147106409-147106431 AGGCAGAAGAGAACAGAAGTTGG + Intergenic
939867820 2:147494149-147494171 AGTCTGAGGCTAGCAGAGGTTGG + Intergenic
940047014 2:149420697-149420719 AGTCTTTGGGGAAAGGAAGTAGG - Intronic
940507542 2:154576258-154576280 AGTCACAGGGGAACAGAACCAGG + Intergenic
941606232 2:167600540-167600562 AGGCTGGGGGGAACAGGAGTGGG - Intergenic
942740811 2:179175504-179175526 AGTCTAGGGGAAACATAAGTTGG - Intronic
943642476 2:190374511-190374533 TATCTGATGGGAACAGGAGTTGG + Intergenic
943877409 2:193088863-193088885 TGTCTGAGGGCAAGAGAAGATGG - Intergenic
944191631 2:197010024-197010046 AGTGTGAGGGGAGCAGGAGCAGG + Intronic
947468195 2:230373100-230373122 AGTCTGAAGGTAACACCAGTTGG + Intronic
947536475 2:230942965-230942987 AATCCTAGGGGAACAGAAGCAGG - Intronic
947550038 2:231038839-231038861 AGGCTGAGGGACACAGCAGTTGG - Intronic
947869762 2:233428100-233428122 GGTGTTAGGGGAACAGGAGTAGG + Intronic
1168792046 20:584588-584610 AGTGGTAGGTGAACAGAAGTGGG - Intergenic
1169084666 20:2819296-2819318 AGTCTGTGGGGAAAGGAAGAAGG - Intronic
1170518930 20:17162975-17162997 AGTGTGAGGGGAAAAGTACTTGG - Intergenic
1171776477 20:29372950-29372972 AGTCTAATGGGAGCAGAGGTAGG + Intergenic
1171937469 20:31288672-31288694 AGTTTGAGGAGAACACAATTTGG - Intergenic
1173338393 20:42131964-42131986 AGTGTGAGGGGAACAGCGATGGG + Intronic
1173652415 20:44675152-44675174 TGTCTGTGAGGGACAGAAGTTGG - Intergenic
1174712415 20:52720967-52720989 TGTCTGAGGGCAGGAGAAGTCGG + Intergenic
1177486875 21:21769536-21769558 AGTCTGAAGGGCAAAGAATTAGG - Intergenic
1177816359 21:25981415-25981437 AATGTGGGGGGAAAAGAAGTAGG - Intronic
1178348334 21:31851199-31851221 CCTCTGAGGGGAACAAAAGCCGG - Intergenic
1178706871 21:34883040-34883062 ACTGTGAGGGGAACAGCAGTAGG - Intronic
1180287768 22:10766261-10766283 AGTGTGAGTGGAAAAAAAGTGGG + Intergenic
1180398799 22:12388901-12388923 AGCCTGAGTGACACAGAAGTTGG + Intergenic
1180491502 22:15853599-15853621 AGATTGAGGGGCACAGAACTAGG - Intergenic
1181162597 22:20967082-20967104 GCTCTGTGGTGAACAGAAGTGGG - Intronic
1183757925 22:39787713-39787735 AGTCTGAAGCTAGCAGAAGTTGG + Intronic
1184735262 22:46394260-46394282 AGTCTGTGGGGAAAATAAGAGGG + Exonic
1185040197 22:48500008-48500030 AATTTGAAGGGAACAGAAGGTGG - Intronic
1185279908 22:49965615-49965637 AGTGTGTGGGGCACAGCAGTGGG - Intergenic
1185382408 22:50515997-50516019 AGGCTGAGGGGAGCAGAGGAAGG + Intronic
950549359 3:13656761-13656783 AGTGGGAGGTGAACAGTAGTTGG + Intergenic
952004521 3:28827216-28827238 ACTCTGAGGAGAAAAGAAATGGG - Intergenic
952395844 3:32919843-32919865 GGGCTGCTGGGAACAGAAGTAGG + Intergenic
953277388 3:41515702-41515724 ATTATGAGGAGAACAGAAGGAGG + Intronic
953512410 3:43555605-43555627 AGCCTGAGGGTGTCAGAAGTTGG - Intronic
954050820 3:47975622-47975644 ATTCTGAAGGAAACAGAAATGGG + Intronic
954838598 3:53493156-53493178 AATCTGAAGGGAATAGAAGACGG - Intergenic
955070980 3:55572259-55572281 GGACCGAGGTGAACAGAAGTGGG - Intronic
955729645 3:61971277-61971299 ACTCTGAAGCGAATAGAAGTAGG + Intronic
955803429 3:62709182-62709204 AGTGTTAGGGGAAGAGAAGAGGG - Intronic
956307908 3:67847060-67847082 AGTTTGACTGGAACAGAAGGTGG + Intergenic
957030305 3:75233051-75233073 AGACTGAGGGATACAGAAGATGG + Intergenic
959826538 3:110803684-110803706 TGTCAGAGGGCAAGAGAAGTTGG + Intergenic
959910919 3:111762731-111762753 AGTCTGTGGGGATCAGAGCTGGG - Intronic
961125974 3:124418059-124418081 AGTGTGGGTGGAACAGATGTAGG + Intronic
963713740 3:148779124-148779146 AGGCTGAGAATAACAGAAGTTGG + Intergenic
964297049 3:155245388-155245410 TGTCTGAGGGCAAGAGAAGTTGG - Intergenic
965737515 3:171837067-171837089 AGATAGAGGGGAACACAAGTTGG + Intergenic
967251950 3:187548991-187549013 TGTCTGTGGGGGACAGAAGAGGG + Intergenic
967491883 3:190101607-190101629 AGTCTGAAGCAAGCAGAAGTTGG + Intronic
969229797 4:5822020-5822042 GGACTGAGGGGCACAGAAGAGGG - Intronic
969351490 4:6600525-6600547 AGTATGAGGGAAACTGAGGTAGG - Intronic
969544789 4:7818635-7818657 AGGCAGAGGGGCACAGCAGTGGG - Intronic
970169425 4:13274995-13275017 AGACTGAGGAGAGGAGAAGTGGG - Intergenic
970345536 4:15149117-15149139 AGTCTGAAAGCAATAGAAGTAGG + Intergenic
970490924 4:16572886-16572908 AGGCGGAGGGGAAAAGAAGGAGG + Intronic
970595977 4:17600591-17600613 AGTCTGAGGGGTTGAGAAGGTGG + Intronic
970631661 4:17953399-17953421 AATTTGAGGGGAACAGATGCAGG - Intronic
971503429 4:27341151-27341173 AAGCTGTGGGGATCAGAAGTGGG + Intergenic
973600340 4:52536495-52536517 AATCTGAGGAGAACTGAAATTGG - Intergenic
975238760 4:72032059-72032081 AGTCCGCGGGGGACAGACGTCGG + Exonic
976532161 4:86168123-86168145 AGTCTGAGCGACACAGAAGACGG + Intronic
976946817 4:90780583-90780605 AGTCTGAAAGGAAAAGAAATAGG + Intronic
977705103 4:100061857-100061879 AGTGTGGTGGGAGCAGAAGTAGG - Intergenic
979933692 4:126665203-126665225 AGTCTGAAGCTAGCAGAAGTGGG + Intergenic
981188436 4:141833673-141833695 AGTGTGAGTGACACAGAAGTTGG + Intergenic
985787241 5:1903453-1903475 TGTCTGAGGGAAGAAGAAGTGGG + Intergenic
987494277 5:18622722-18622744 AGTGGGAGTGGAACAAAAGTAGG + Intergenic
987846733 5:23296300-23296322 ACTCTTAGGGGACCACAAGTGGG - Intergenic
992596903 5:78356381-78356403 ACTCTGAGGGGAAAAGAAACAGG + Intergenic
993760696 5:91793312-91793334 TGTCTGAGGGCAAGAGAAGATGG - Intergenic
993956164 5:94235443-94235465 AGTCTGAAGGTAGCAGAACTTGG + Intronic
995243464 5:109911477-109911499 AGGTTGAGGGGAAAAGAAGATGG + Intergenic
995782483 5:115793160-115793182 AGGCTGAGTGGAAAAGCAGTGGG - Intergenic
996583370 5:125056773-125056795 AGCCTGAGAGCATCAGAAGTTGG + Intergenic
997457657 5:134029110-134029132 AGTCCTAGGCAAACAGAAGTGGG + Intergenic
997943537 5:138179532-138179554 AATTGGAGGGGAAAAGAAGTAGG + Intronic
1001056699 5:168455537-168455559 ACCCTGAGGGGAGCAGAAGAGGG - Intronic
1001149032 5:169210672-169210694 AGTCAAAGGGGACCAGAGGTAGG + Intronic
1003187697 6:3847437-3847459 AGTCTGAAGGTAGCAGAGGTTGG - Intergenic
1004012620 6:11703685-11703707 ATTGTGAAGGGAACAGAAGCAGG + Intergenic
1006054954 6:31377460-31377482 AGTCCTAGGGGATCAGAAGTAGG - Intergenic
1007008464 6:38391141-38391163 AGGCTGAGGGGAACAGAATTTGG + Intronic
1007131926 6:39483227-39483249 AGTCTGAAGGAAAAATAAGTAGG + Intronic
1007409350 6:41652916-41652938 AGACTGAGGTTAAGAGAAGTCGG - Intronic
1007527209 6:42507001-42507023 AGTGTGTGGGAAACAGAATTTGG - Intergenic
1008255010 6:49287579-49287601 AGTCTGAAACCAACAGAAGTTGG - Intergenic
1009350540 6:62671523-62671545 TGTCTGAAGGCAAAAGAAGTTGG + Intergenic
1011745846 6:90407140-90407162 AGTGTGGGGAGAGCAGAAGTTGG - Intergenic
1015870003 6:137766723-137766745 ACTCTGAGGGGATCAGAGGGAGG - Intergenic
1015966072 6:138696177-138696199 AGTCTCAAGGGAATAGAAGAGGG - Intergenic
1016061940 6:139639777-139639799 AGTCAGAGAGGCACATAAGTAGG + Intergenic
1017086859 6:150721183-150721205 AGCCTGAGTGGAGCAGAGGTAGG + Intronic
1017917616 6:158844175-158844197 AGGCAGAGGTGAACAGAAGACGG + Intergenic
1018681693 6:166270530-166270552 AGTCTGACTGGAACAGCACTAGG + Intergenic
1019219485 6:170462954-170462976 GCTCTGAGGAGGACAGAAGTGGG + Intergenic
1019305953 7:335844-335866 ATGCTTAGGGGCACAGAAGTGGG - Intergenic
1020473864 7:8571421-8571443 AATTTGGGGGGAACAGAGGTGGG + Intronic
1020572685 7:9885539-9885561 AGTCTGATCAGAAAAGAAGTAGG - Intergenic
1020762842 7:12289704-12289726 CATGAGAGGGGAACAGAAGTGGG - Intergenic
1021349283 7:19569957-19569979 AGAAAAAGGGGAACAGAAGTTGG - Intergenic
1021867387 7:24971579-24971601 AGTCTGCTGGGACCAGAAGGAGG - Intronic
1023178959 7:37461833-37461855 AGTCTGAGAAGAACAAAAGAAGG - Intergenic
1023724454 7:43127715-43127737 AGTCTGAAGCTAGCAGAAGTTGG + Intronic
1023962423 7:44937950-44937972 AGTCTGAGCTGAACGGCAGTGGG + Intergenic
1024571418 7:50725717-50725739 AGTAGGAGGAAAACAGAAGTGGG + Intronic
1025595208 7:62914913-62914935 AGTGTGAGGGACACAGAAGACGG - Intergenic
1026070341 7:67113245-67113267 ATTCTGGAGGGAACAGAAGATGG - Intronic
1026233575 7:68506638-68506660 AGTCCGAGGGAAAAAGAAGATGG - Intergenic
1026706565 7:72699023-72699045 ATTCTGGAGGGAACAGAAGATGG + Intronic
1029364284 7:100107255-100107277 AGGCTGAGGGGAGCCGGAGTTGG + Exonic
1029620945 7:101689343-101689365 AGTCTCAGAGGGACAGAGGTAGG - Intergenic
1030743134 7:113133540-113133562 AGTCTGATGGGCAGGGAAGTAGG + Intergenic
1033046385 7:137966092-137966114 GGACTTAGGTGAACAGAAGTTGG + Intronic
1034059303 7:148071523-148071545 AGTGTGAGAGGAACAGCAGAAGG + Intronic
1034263914 7:149772551-149772573 AGTCCGAGGGGAGCAGAAATAGG - Intronic
1034461215 7:151199021-151199043 AGGCTGAGGGGCTCAGGAGTGGG + Intronic
1037417168 8:18664490-18664512 AGTTTGAAGGTAACAGATGTCGG + Intronic
1037535123 8:19817022-19817044 AGTTTGAGAGGAACAGCAGAGGG - Intergenic
1039953655 8:42191151-42191173 ATTCTGAGGGGAGCAGAAACAGG - Intronic
1041483686 8:58350461-58350483 ACACTGTGGGGAACAGAAGCTGG - Intergenic
1042151102 8:65785237-65785259 AGGCTGAGGGATACAGAGGTAGG + Intronic
1042153837 8:65819933-65819955 AGTCTGTGGGGAGGAGAAGGAGG - Intronic
1042669351 8:71244664-71244686 AGTCCAAGGGAAACTGAAGTGGG + Exonic
1043151369 8:76720678-76720700 AGTCAGAGAAGAACAGAAGATGG - Intronic
1043662275 8:82758552-82758574 AGTCAGAGGGGATCCAAAGTAGG + Intergenic
1043832065 8:85001548-85001570 AGGCTGAGGGGAAAGGAATTAGG + Intergenic
1044454589 8:92378332-92378354 TCTTTGAGGGGGACAGAAGTTGG + Intergenic
1045010593 8:97955399-97955421 GGTCTGAGGGGTACAGGAGAGGG + Intronic
1045614606 8:103895239-103895261 ACTCTCAGTGGAACAGAGGTTGG - Intronic
1046157342 8:110309941-110309963 AGTTTGAGGGGAAAAAAAATAGG + Intergenic
1046289558 8:112139055-112139077 AGAATGAGGGGAAAAGAAGAGGG + Intergenic
1046853287 8:119000252-119000274 AGTGAGAGGGGAAGAAAAGTCGG + Intronic
1047518928 8:125579477-125579499 AGTTAGAGTGGAACAGAAGAGGG - Intergenic
1048306794 8:133290089-133290111 AGTCTGAGGCTGGCAGAAGTGGG - Intronic
1051089904 9:13394324-13394346 AGTCTGATGGCAACAGAGTTGGG - Intergenic
1052907704 9:33851082-33851104 ATTCAGAGGGGAATAGAAGTGGG - Intronic
1054896771 9:70322403-70322425 AGTCCAAAGTGAACAGAAGTAGG - Intronic
1055742583 9:79406327-79406349 TGTCTGAGGGAAACAAAAGGTGG - Intergenic
1057412338 9:94827823-94827845 AGAGAGAGGGGTACAGAAGTAGG + Intronic
1060257539 9:122045884-122045906 AGGCTGAAGGGAACAGAAATAGG + Intronic
1060375475 9:123112461-123112483 AGTCTGACGTGAACAGAAGGTGG - Intronic
1062569742 9:137179605-137179627 AGTAGGAGGGGAGCAGATGTGGG - Intronic
1185534192 X:846580-846602 AGAATGAGAGGAACTGAAGTCGG + Intergenic
1188106306 X:26151752-26151774 AATCTGAGGGGAACTGGAGGAGG - Intergenic
1188423571 X:30020781-30020803 TTTGTGAGGGGCACAGAAGTAGG - Intergenic
1191048312 X:56162844-56162866 AGTGTGAGCGGCACAGAAGATGG - Intergenic
1192246605 X:69378294-69378316 AGTCTTTGGGGTACAGGAGTGGG - Intergenic
1193067432 X:77274940-77274962 AGCCTGAGGGCAGCAGGAGTGGG - Intergenic
1193444005 X:81577511-81577533 AGTCTGAGGGCAGCAGGGGTGGG - Intergenic
1193531573 X:82660722-82660744 AGTGTGAGGGGAACACATGTGGG - Intergenic
1193861417 X:86672756-86672778 AGTGTGAGGGGAAAAAATGTGGG + Intronic
1194396211 X:93389539-93389561 AGTCTGAGGAGAAGACAGGTGGG + Intergenic
1195241859 X:102960244-102960266 AGCCTGAGGGAAACAGGAGCAGG + Intergenic
1196252093 X:113473158-113473180 AGTCAGAGAGAAACAGAAGAGGG + Intergenic
1196999039 X:121417412-121417434 AGTCAGAGGGAATCATAAGTAGG + Intergenic
1197806066 X:130399683-130399705 AGTCTGAGTTGAAAAGAGGTGGG - Intergenic
1198253913 X:134908462-134908484 AATCAGAGGGAAACAGAAGGAGG - Intronic
1198816770 X:140599792-140599814 AGTCTGTAGAGAACAGCAGTAGG + Intergenic
1199266899 X:145838682-145838704 ATTTTGAGGGGAAGAGAACTTGG + Intergenic
1199991002 X:152987811-152987833 AGTCTGTGGGCGACAGAACTGGG - Intergenic
1200034089 X:153317285-153317307 AGTCTGTGGGCGACAGAACTGGG - Intergenic
1200375291 X:155774046-155774068 AGACTGCGGGGGAGAGAAGTAGG - Exonic
1201596946 Y:15680739-15680761 AGTTGGAGGGGAACAAAAGGGGG + Intergenic