ID: 1130401741

View in Genome Browser
Species Human (GRCh38)
Location 15:83562261-83562283
Sequence GCTCCAGTATGTGCATGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130401741 Original CRISPR GCTCCAGTATGTGCATGTCA GGG Intronic
903905468 1:26682825-26682847 GCTCCAGTCTGTGAATCTCCTGG - Intergenic
904447689 1:30588176-30588198 CCTCCAATATCTGCATGTCATGG + Intergenic
917314527 1:173710655-173710677 GCTCCAGCATGTGCATTAAAGGG - Intergenic
917835278 1:178937009-178937031 GCTTCAGTATATGAATGGCAGGG + Intergenic
922235325 1:223718118-223718140 GCTCCAGGAGGTGCATACCAAGG - Intronic
1062775355 10:140760-140782 GCTTAAGTATGTGCACGTAAGGG - Intronic
1063416576 10:5877921-5877943 ACTCCATAATGTGCCTGTCATGG + Intronic
1064454852 10:15477949-15477971 GGTCCCGTCTGTGCATGTCTAGG + Intergenic
1064951631 10:20857542-20857564 GCTCCATTTTGTACATCTCATGG - Intronic
1075094144 10:119460169-119460191 GTTCCAGCATGTGCCTGGCATGG - Intergenic
1081584459 11:44374929-44374951 GCACCACTATTTGCCTGTCAAGG - Intergenic
1081647272 11:44798799-44798821 TTTCCAGTTTGTGCATTTCAGGG + Intronic
1085963936 11:81498085-81498107 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1091653169 12:2324567-2324589 GCTCCAGCAGGTGCAGCTCAGGG - Intronic
1106394435 13:29366780-29366802 CCTCCAGTAGTTGCCTGTCAAGG + Intronic
1113163646 13:107412247-107412269 GCACCAGTCTAAGCATGTCACGG + Intronic
1113874074 13:113583830-113583852 GCACTAGTGTGTGCATGTGAGGG - Intergenic
1113874080 13:113583870-113583892 GCACTAGTGTGTGCATGTGAGGG - Intergenic
1113874086 13:113583910-113583932 GCACTAGTGTGTGCATGTGAGGG - Intergenic
1114630314 14:24155318-24155340 GCTGCAGTACCTGGATGTCAAGG - Exonic
1114796912 14:25726404-25726426 GGTACAGTATCTGCATGTCAAGG + Intergenic
1119016052 14:71056344-71056366 GCTCTGGTATGTGCTTGTAAAGG + Intronic
1120451595 14:84674909-84674931 GCTCCACTATTGGCATGTCTTGG - Intergenic
1123123669 14:105929619-105929641 GCTCCCGTCTGGGCATGTCCTGG + Intronic
1123406307 15:20021119-20021141 GCTCCTGTCTGGGCATGTCCTGG + Intergenic
1123504972 15:20932907-20932929 GGTCCAGTCAGTGAATGTCAGGG - Intergenic
1123515637 15:21027767-21027789 GCTCCTGTCTGGGCATGTCCTGG + Intergenic
1123562217 15:21506601-21506623 GGTCCAGTCAGTGAATGTCAGGG - Intergenic
1123598462 15:21943888-21943910 GGTCCAGTCAGTGAATGTCAGGG - Intergenic
1128720823 15:69947181-69947203 GATCCAGTGAGTGTATGTCATGG + Intergenic
1129741576 15:77992162-77992184 GCTGCAGGCTGTGCTTGTCAGGG - Intronic
1129844069 15:78760217-78760239 GCTGCAGGCTGTGCTTGTCAGGG + Intronic
1130401741 15:83562261-83562283 GCTCCAGTATGTGCATGTCAGGG + Intronic
1130597203 15:85256380-85256402 GCTGCAGGCTGTGCTTGTCAGGG + Intergenic
1202970562 15_KI270727v1_random:233743-233765 GGTCCAGTCAGTGAATGTCAGGG - Intergenic
1133911401 16:10069639-10069661 GCTCAAGTGTGTGCATCTAATGG - Intronic
1142271235 16:89090531-89090553 CTTCCAGCAGGTGCATGTCATGG - Intronic
1146107792 17:30057758-30057780 GCTCCAGTTTGTGCAACTCCTGG + Exonic
1147039577 17:37708128-37708150 GAACCAGTATGTGCAAGTCTTGG - Intronic
1149963680 17:61140257-61140279 GGTCCAGTATGTGTATGTCTTGG - Intronic
1151805259 17:76400956-76400978 GCTCCAGGGTGTGGAGGTCAAGG + Intronic
1152886331 17:82852693-82852715 ACTTCAGTATGTGGATTTCAGGG + Intronic
1155445160 18:25903485-25903507 GATCCAGTAATTTCATGTCAGGG + Intergenic
1155574663 18:27231624-27231646 GGACCAGTATAAGCATGTCAGGG + Intergenic
926626271 2:15092681-15092703 CCTCCAGTATGTCCAATTCACGG + Intergenic
931879737 2:66555959-66555981 GCTCCAGTGTGTGCACGCCGAGG + Intronic
933344658 2:81067343-81067365 GTTCCAGGATGTGCCTGTGAGGG - Intergenic
933400582 2:81791812-81791834 GATCAAGTATGTGGAGGTCATGG - Intergenic
942509347 2:176680124-176680146 ACTCCACTATTTACATGTCAGGG - Intergenic
946722806 2:222628698-222628720 GCTACACTATGTGCATTACATGG - Intronic
947186781 2:227462788-227462810 GCTCCAGGATGTGCACTTGAAGG - Intergenic
1170438052 20:16350488-16350510 GCTCCAGTATACCCATGTCCTGG - Intronic
1175659270 20:60798169-60798191 GCTCCAGGATGTGGAAATCAAGG + Intergenic
1176055567 20:63145002-63145024 TCCCCCGCATGTGCATGTCAAGG + Intergenic
1179800133 21:43807859-43807881 GCTTCAACATGTGCTTGTCAGGG + Intergenic
1179958246 21:44752983-44753005 GCACGTGTATGTGCATGTGAGGG + Intergenic
1179990762 21:44947201-44947223 GATGCAGTATCTGCATGACATGG - Intronic
1180782708 22:18529785-18529807 GCTCCAGGAGGTGCAGGTGAAGG + Intronic
1181126268 22:20703812-20703834 GCTCCAGGAGGTGCAGGTGAAGG + Intergenic
1181239598 22:21469123-21469145 GCTCCAGGAGGTGCAGGTGAAGG + Intergenic
949876915 3:8632323-8632345 GCTCTAGTTTGAGCCTGTCAGGG - Intronic
950203071 3:11058272-11058294 GCTCCAGTCTTTGGATTTCAAGG + Intergenic
952784304 3:37137341-37137363 GCTCCAGTATTTGCTTGTCTGGG - Intronic
956111334 3:65872455-65872477 CCTCCAGTGTGTGCAGGTTAGGG - Intronic
959338992 3:105103805-105103827 GCTGCAGAATGTGCAGATCAGGG + Intergenic
960760828 3:121072635-121072657 GCTCCAGTAAGGGCATGGTAAGG + Intronic
964743943 3:159994257-159994279 GCTCCAGGATGTGCATGCAAGGG + Intronic
971596347 4:28533999-28534021 CCTCCTGTATGTGCTTGTGATGG + Intergenic
971830080 4:31680730-31680752 GCTCTATTATGTGCTCGTCACGG - Intergenic
974621684 4:64363700-64363722 GGACCAGTATAAGCATGTCAGGG + Intronic
975663481 4:76710172-76710194 GCACCAGTATCTGCATGGCCTGG - Exonic
983408437 4:167363677-167363699 GCTCCAAGATGTACATGTAAAGG - Intergenic
986269377 5:6217838-6217860 GCTTCAGTGTGTGCATCACATGG - Intergenic
988293659 5:29325445-29325467 TCTCCAGTATCTGCTTGTAAGGG + Intergenic
1001752935 5:174145358-174145380 GCTTCATTAGGTGCAAGTCATGG + Intronic
1002458257 5:179358422-179358444 GCTTCAGTATGTGAATTTGAAGG - Intergenic
1009494567 6:64331452-64331474 GCTCCAGTAAGGGCATGGTAAGG - Intronic
1009699151 6:67153874-67153896 GCTCCAGGATTTAGATGTCACGG + Intergenic
1012469119 6:99550249-99550271 GCTCCAGTATGTGCAGGACATGG - Exonic
1028197462 7:87923909-87923931 TTTCCAGTTTGTGCATGTGAAGG - Intergenic
1028820764 7:95209314-95209336 GCTTCAGTATGAGAATATCATGG + Intronic
1030996254 7:116361959-116361981 GCTGCAGTGTTTCCATGTCAGGG - Intronic
1035888643 8:3320880-3320902 GGTGCAGAATATGCATGTCAGGG - Intronic
1037720430 8:21439178-21439200 ACTCCAGAATGTGCTTCTCAGGG + Intergenic
1039982063 8:42416146-42416168 GCTCCAGAATATGCAAGCCAGGG + Intergenic
1041799835 8:61787024-61787046 GCTCCAGAAAGTGCAGGCCATGG - Intergenic
1043799356 8:84588148-84588170 GGACCAGTATGTGCATTTCAGGG + Intronic
1043885111 8:85590008-85590030 GCTCAAGTATGTGCATTAAAAGG + Intergenic
1045035284 8:98171879-98171901 GCTTCAGTATGTGAATCTTAGGG + Intergenic
1047148087 8:122228692-122228714 TTTCCAGTTTGTGCATGTAAAGG - Intergenic
1048181801 8:132202039-132202061 GCTCCAGAATGTGCAAGCCCTGG - Intronic
1048915183 8:139175897-139175919 GCTTCAATATGTGAATTTCAAGG - Intergenic
1051609320 9:18945912-18945934 GCTCCAGTCTGTGCAAGGGAGGG + Intronic
1054810219 9:69428438-69428460 TCTCCAGTGTGAGCATTTCAGGG - Exonic
1055030109 9:71765683-71765705 GGTCCAATAAGTGCATGTCTGGG - Intronic
1059200796 9:112414091-112414113 GGACCAGTATATGCATGCCAGGG + Intronic
1059490662 9:114664139-114664161 GCTCCAGTATTTGCAAATTAAGG - Intergenic
1185814915 X:3145808-3145830 GCTCCCTTGTGTGCATGGCATGG - Intergenic
1188207264 X:27375784-27375806 GCACCAGTATAAGCATGCCAGGG - Intergenic
1189516726 X:41719873-41719895 GCACCAGTATAAGCATGCCAGGG + Intronic
1195225327 X:102786405-102786427 TTTCCTGTATGTGAATGTCATGG - Intergenic
1198266995 X:135018800-135018822 GTTCTATTATGTGCATTTCATGG - Intergenic
1199234474 X:145475060-145475082 GGACCAGTATGAGCATGCCAGGG + Intergenic
1199312157 X:146333018-146333040 GGACCAGTATAAGCATGTCAGGG + Intergenic
1199449717 X:147965893-147965915 GCTCCAATTTTTGCATCTCAAGG - Intergenic