ID: 1130403243

View in Genome Browser
Species Human (GRCh38)
Location 15:83576583-83576605
Sequence CATCACCTGAAAAAGCTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130403237_1130403243 28 Left 1130403237 15:83576532-83576554 CCAGGTTTTGAATGTAGCACCTC 0: 1
1: 0
2: 0
3: 14
4: 99
Right 1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 178
1130403241_1130403243 -6 Left 1130403241 15:83576566-83576588 CCATTCTCTTTTTTTAGCATCAC 0: 1
1: 0
2: 0
3: 42
4: 526
Right 1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 178
1130403240_1130403243 9 Left 1130403240 15:83576551-83576573 CCTCTCTGAGGGACTCCATTCTC 0: 1
1: 0
2: 0
3: 19
4: 190
Right 1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130403243 Original CRISPR CATCACCTGAAAAAGCTGGA AGG Exonic
900155902 1:1203189-1203211 CAGCACCAGAAAGTGCTGGATGG + Intergenic
900764670 1:4496001-4496023 CATCAACTGCAAAAGACGGAAGG - Intergenic
905675871 1:39824695-39824717 GGCCACCTGGAAAAGCTGGAGGG + Intergenic
907937540 1:59056286-59056308 CATCATGTGAAAAAGCTGGGAGG + Intergenic
908030631 1:59995543-59995565 CATCTCCTGCAAAAGTTAGAAGG - Intronic
908642453 1:66240444-66240466 CACCGCCTGAGAAAGGTGGATGG + Intronic
909280459 1:73744925-73744947 AAACAACAGAAAAAGCTGGAAGG + Intergenic
909308951 1:74121287-74121309 CATGACATGGAAAAGTTGGATGG - Intronic
911076536 1:93880666-93880688 CATCAGGTGAAAAATCTAGAAGG - Intergenic
911883846 1:103272521-103272543 CATCACATGAAAAAGGAGAAAGG - Intergenic
912087531 1:106028152-106028174 CTTCAGCTGAAAAAGCTTGCGGG + Intergenic
916717499 1:167457483-167457505 TATCACCTGCAAAGCCTGGAAGG + Intronic
918040002 1:180908219-180908241 CATCACCTGGGAATCCTGGAAGG + Intergenic
918841039 1:189539944-189539966 GATCACCTGAAAGACCTGAAAGG - Intergenic
919035372 1:192300852-192300874 CAGCATCTGAAAAATCTGAAGGG + Intergenic
919641060 1:200043871-200043893 CCTCACCTGTGAAAGCTGCAAGG + Exonic
921598016 1:217075899-217075921 CAGCACATGAAAAAGCATGAGGG - Intronic
922207958 1:223465548-223465570 CATCCCCTGAAATGCCTGGAGGG + Intergenic
923878149 1:238073529-238073551 AATCATTTGAAAAAGTTGGAGGG + Intergenic
923887364 1:238173989-238174011 CATGACCTAAAAAATTTGGAAGG + Intergenic
1069589239 10:69631559-69631581 CCTGACCTCAAAAAGCTTGAAGG - Intronic
1069710026 10:70482167-70482189 CCTCTCCTGTGAAAGCTGGAGGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1071741964 10:88369445-88369467 CAACACCTGGCAAAGCAGGAAGG - Intronic
1075285970 10:121186301-121186323 CATGACCTGTCCAAGCTGGAAGG + Intergenic
1076710166 10:132328901-132328923 CATGACCCCAAAAGGCTGGACGG + Intronic
1077700433 11:4436392-4436414 CAGCACGTGTAAAACCTGGAAGG + Intergenic
1078166509 11:8890367-8890389 CAGCAACAGAACAAGCTGGATGG + Intronic
1079829007 11:25237406-25237428 CATCAGCTGAGAATGATGGATGG + Intergenic
1081745350 11:45468970-45468992 CATCACCCAGAAAAGCTGGCAGG + Intergenic
1083585182 11:63852004-63852026 CATCACCTGAAAGAGTCTGAGGG - Intronic
1084804603 11:71570135-71570157 CATCCTCTGAAAAAGATGAAGGG + Intergenic
1084805850 11:71578493-71578515 CATCCTCTGAAAAAGATGAAGGG - Intergenic
1085053104 11:73389768-73389790 CAGCACCTGCTAAGGCTGGAAGG - Intronic
1085770602 11:79322201-79322223 TGTCACTTGAAAAAGCTGAAGGG - Intronic
1085936977 11:81158327-81158349 TATCACCTGACAAAGCTCAAGGG + Intergenic
1087061209 11:93979611-93979633 CATTCCTTGAAAAAGGTGGAAGG + Intergenic
1087215230 11:95486691-95486713 CACCAGCTGGCAAAGCTGGATGG - Intergenic
1088685570 11:112281889-112281911 CAGCACCTGAAAAAGGGGAAGGG - Intergenic
1088859873 11:113789722-113789744 CACCACCTGTAGAAGCTGGAGGG + Intergenic
1090541256 11:127708615-127708637 CTTGCCCTGGAAAAGCTGGAGGG - Intergenic
1093575877 12:20729476-20729498 CATAAACTGAAAAAGCTAGCAGG + Intronic
1094530013 12:31265599-31265621 CAGCACATGAAAATGCTGGACGG - Intergenic
1095189908 12:39245850-39245872 CATCACTTGGAAAAGCAGGTAGG + Intergenic
1095310900 12:40695222-40695244 CATCATCCTAAGAAGCTGGATGG + Intronic
1095849026 12:46780200-46780222 GTCCACCTGAAAGAGCTGGAAGG - Intronic
1096213022 12:49780837-49780859 CATCAACTGAGAAAGATGGCAGG - Intergenic
1098194836 12:67988684-67988706 CATGACCTGAAAAGGCAGGCAGG + Intergenic
1098381049 12:69869903-69869925 TATCACCTCAACTAGCTGGAGGG + Intronic
1098730002 12:74023962-74023984 CAACACCTGAAAACCATGGAAGG + Intergenic
1099963837 12:89423596-89423618 CATCACCTAACTAAGTTGGACGG - Intronic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101824716 12:108211107-108211129 AATTACCTGAAAAGGCTGTAGGG - Intronic
1105481510 13:20781789-20781811 CAACAGCTGAGAAAGCTTGAGGG + Exonic
1107202068 13:37733407-37733429 CATCATCTCCAAAAGCTTGATGG - Intronic
1107531059 13:41282751-41282773 TATCACCTGCCAAATCTGGAAGG + Intergenic
1109220660 13:59637922-59637944 AATCATATTAAAAAGCTGGAGGG + Intergenic
1109587145 13:64421107-64421129 TATTACTTGAAAAAACTGGATGG + Intergenic
1113961608 13:114129412-114129434 CCTCACCTGCAAGAGCTGGAAGG + Intronic
1119315323 14:73689494-73689516 CCCAAACTGAAAAAGCTGGATGG + Exonic
1119942712 14:78658042-78658064 CACCACCTGAGAAATCAGGAAGG - Intronic
1126351842 15:47752072-47752094 CAGAACCTGAAAAACCTTGAAGG + Intronic
1126359051 15:47826856-47826878 TATCACCTGAAAATGCTAAAAGG + Intergenic
1127367181 15:58302080-58302102 ATTCACCTGAAAAAGAGGGAGGG + Intronic
1127383583 15:58449895-58449917 CATCACCAGACAAAGCAGAATGG - Intronic
1127923395 15:63513240-63513262 CATCACCAGAAAAAGCAGGCTGG + Intronic
1128895997 15:71374603-71374625 CAGCCTCTGAAGAAGCTGGAGGG - Intronic
1130403243 15:83576583-83576605 CATCACCTGAAAAAGCTGGAAGG + Exonic
1133306412 16:4812342-4812364 CATCACCTTCCAGAGCTGGAGGG + Intronic
1137006237 16:35276417-35276439 CATCACCTGAAGACGCTCCAGGG - Intergenic
1139902350 16:70338057-70338079 CATCTCCTGAAAAAGAAGGTAGG + Intronic
1140507300 16:75481886-75481908 CAGCACCTGGTAAAGCAGGAGGG + Exonic
1140848487 16:78912334-78912356 CATCACCTCCCAGAGCTGGAAGG - Intronic
1146169887 17:30624860-30624882 CACCACCTGCAGAAGCTAGAGGG + Intergenic
1146343340 17:32040890-32040912 CACCACCTGCAGAAGCTGGAGGG + Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148381967 17:47206370-47206392 CCTCAGAAGAAAAAGCTGGAAGG - Intronic
1149507879 17:57211122-57211144 CTTCAGCAGAAAAAGGTGGAGGG + Intergenic
1150782605 17:68135120-68135142 CACCACCTGCAGAAGCTGGAGGG - Intergenic
1153087289 18:1302859-1302881 GAACACCTGCAAAAGCTGGAAGG - Intergenic
1153207735 18:2720983-2721005 CATCCCCAGCAAAAGATGGAAGG - Intronic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1155394404 18:25371591-25371613 AATCACCTGCAAAACTTGGACGG - Intergenic
1157777621 18:50408205-50408227 CCTTAGCTGAGAAAGCTGGACGG + Intergenic
1159037616 18:63292910-63292932 CATCACCTGCAGCAGCAGGAAGG - Intronic
1160790420 19:920384-920406 CAGCACCAGGAACAGCTGGATGG - Exonic
1161454631 19:4363856-4363878 CACCACCTGAAGAAACTGGAGGG - Exonic
1162803163 19:13122167-13122189 CAGCACATGAGAAGGCTGGAGGG - Intronic
1164273786 19:23699236-23699258 CATCACCTGAGAATCCTGAACGG - Intergenic
925437182 2:3849031-3849053 AAGCACTTGAAAATGCTGGAAGG + Intergenic
927890622 2:26745855-26745877 CATCATTTGTAAAAGCTGGATGG + Intergenic
928483396 2:31706314-31706336 CATGAGCTGAAGAAGCTTGAAGG - Intergenic
930014428 2:46960576-46960598 CATCACCTGGGAAAGTTGTAAGG - Intronic
933171900 2:79134124-79134146 GATGCCCTGAAAATGCTGGAGGG - Intergenic
934474612 2:94586152-94586174 GATCTGCAGAAAAAGCTGGAAGG + Intergenic
935272979 2:101451018-101451040 CTTCACCTGAAAAAGGTTAATGG - Intronic
939727547 2:145741585-145741607 CATAACCTGTAAAAACTGGATGG - Intergenic
940265977 2:151838677-151838699 AATCAACTGAAAAATCTGGGGGG - Exonic
940722136 2:157293570-157293592 CATCTCCTGACCAGGCTGGAAGG - Intronic
941337338 2:164262103-164262125 CAGCAACAGAAAAAGCTGGATGG + Intergenic
942883865 2:180898109-180898131 TATCACCTGAATAAGCTGTTTGG - Intergenic
943354755 2:186838953-186838975 CATCACCTGCAAAAGGTGACAGG + Exonic
947957133 2:234201761-234201783 CATCACCTGAAATAGCAAGGTGG + Intergenic
948407725 2:237735142-237735164 CATGACCTGAAAAAGCATGCAGG - Intronic
1169082532 20:2805944-2805966 CAACACCCGAGAAACCTGGATGG - Intergenic
1169322162 20:4641901-4641923 CAGCCCCTGGAAAAGTTGGAAGG - Intergenic
1169636326 20:7696085-7696107 CATCAAGTGAACAAGCTAGAAGG - Intergenic
1169828911 20:9801161-9801183 CATGACCTGAAAAAGTTACATGG - Intronic
1170422526 20:16207024-16207046 CAGCACCTGAGAAAGCCTGAGGG - Intergenic
1171354412 20:24533288-24533310 AACCACCAGAAAGAGCTGGAAGG - Intronic
1175394420 20:58649311-58649333 CATCACCTCACAAAGCAGGGGGG - Intergenic
1178900793 21:36596963-36596985 CACCAACTCAAAGAGCTGGAGGG + Intergenic
1179539798 21:42076769-42076791 CAATACGTGAAAGAGCTGGAAGG + Intronic
1181181051 22:21068777-21068799 CAACTCCTGGAAAAGCTGAAAGG - Intergenic
1182221186 22:28760222-28760244 CATCAGCTGGAAAGGCTGCAGGG + Intergenic
1182613078 22:31565398-31565420 CATCACTTAAAAAGGCGGGAGGG + Intronic
1182715171 22:32352543-32352565 CATCTCCTGCAGAATCTGGAGGG - Intergenic
1184358398 22:43997714-43997736 CATTACCTGCAGAAGCTGCAGGG + Intronic
949342633 3:3045754-3045776 CAGCAATGGAAAAAGCTGGATGG + Intronic
949606878 3:5662862-5662884 CATCACCTCAAGAAGCCAGAAGG - Intergenic
950038050 3:9901528-9901550 CATGAACTCAAAAAGCTAGAGGG + Intergenic
952001375 3:28789236-28789258 CATCACCAGAATTACCTGGAAGG - Intergenic
952707347 3:36392666-36392688 CATCACCTGAAAGCTCTGCAGGG - Intronic
953976653 3:47386558-47386580 CATCCCATGGAAAATCTGGAAGG - Intronic
954218904 3:49140333-49140355 CAACACCAGAGAAAGCAGGAAGG - Intergenic
956873542 3:73440987-73441009 CTGCACCAGAAAATGCTGGAAGG - Intronic
956982739 3:74657799-74657821 CAGCAACTAAAAGAGCTGGAAGG + Intergenic
960181292 3:114582984-114583006 CATCAACTGAAAAACCTAAATGG - Intronic
961783028 3:129332460-129332482 CCTCAGTTGAGAAAGCTGGAGGG + Intergenic
967425299 3:189319888-189319910 CAGCACCTGCAAAAGCTGTAAGG - Intronic
968707314 4:2085957-2085979 CATCACCTGAAACACCTGGCAGG - Intronic
970128783 4:12843683-12843705 CATCAGCTGCAACAGCTGAAAGG - Intergenic
970502895 4:16696267-16696289 CAGCACCTGATCCAGCTGGAAGG - Intronic
970551973 4:17190752-17190774 CTTCACCTGCAAATGCTGCATGG - Intergenic
971101584 4:23472339-23472361 ATTTACCTGAAAAAGGTGGAGGG + Intergenic
973268901 4:48240379-48240401 CAACACAAGAAAAAGGTGGATGG + Intronic
976316927 4:83668460-83668482 CATCACCCAAAGAAGCTGGTGGG - Intergenic
977411595 4:96672947-96672969 CCTCACCTAAAAAAGCTGACTGG - Intergenic
978405010 4:108370202-108370224 CAACTCCTGAAGAAACTGGAAGG - Intergenic
988716780 5:33836413-33836435 GATCAGCTGCAAAACCTGGAAGG + Intronic
988802624 5:34710733-34710755 AATCACCTGCAAGAGCTGGGTGG - Intronic
989656206 5:43748222-43748244 CAGCTCCTCACAAAGCTGGATGG - Intergenic
990849386 5:60184656-60184678 CCTCACCCTTAAAAGCTGGATGG + Intronic
994584208 5:101684838-101684860 CAACAACTCAAAATGCTGGAAGG + Intergenic
997352663 5:133242171-133242193 CAAAACCTGAAACAGCTGCATGG + Intronic
998830272 5:146150248-146150270 TATTACCAGAGAAAGCTGGAAGG - Intronic
1002972976 6:2043380-2043402 CAACACCTTCATAAGCTGGATGG + Intronic
1007500413 6:42292806-42292828 CACCACCTAAAAAAGTTAGAAGG + Intronic
1011764842 6:90609753-90609775 GATCACCTGTAAAAGGTGGGGGG - Intergenic
1015564009 6:134547127-134547149 CATTACCAGAAAAAACGGGAAGG + Intergenic
1021405017 7:20255504-20255526 CAGCACCTAAAAAAGTTTGATGG + Intergenic
1022726760 7:32988259-32988281 CATAACCTGATGAAACTGGAGGG + Intronic
1025046826 7:55699374-55699396 CATAACCTGACGAAACTGGAGGG - Intergenic
1032419693 7:131768185-131768207 CATCCTCTGAAAATGCAGGATGG - Intergenic
1033963439 7:146943658-146943680 CATCACCAGTAAAAGCTAAATGG - Intronic
1035587476 8:786936-786958 CTTCACCTGAAAGAGCTCAAAGG - Intergenic
1038527158 8:28285450-28285472 CATCACACTGAAAAGCTGGAGGG + Intergenic
1039207129 8:35169578-35169600 CACCACCTTAGAAACCTGGAAGG - Intergenic
1040709487 8:50171057-50171079 CATCAGATGACAAAGGTGGAAGG - Intronic
1044844236 8:96364565-96364587 CCTCATCTGAAATATCTGGAGGG + Intergenic
1045158604 8:99509725-99509747 CAACACCTGAAAAAGTTAGTAGG - Intronic
1045740098 8:105347752-105347774 AAACACTTGAATAAGCTGGAGGG - Intronic
1046851272 8:118975904-118975926 CAACACCTGACAAAGATAGAAGG - Intergenic
1047342427 8:123994786-123994808 CATCACCTGAGTTAGCTGGCAGG + Intronic
1048207017 8:132423425-132423447 CATCATCTGAAAAGGCAGGAAGG + Intronic
1048708162 8:137178040-137178062 CATGACTAGCAAAAGCTGGAAGG + Intergenic
1051502134 9:17789392-17789414 CATCATCTAAAGAAGTTGGAGGG + Exonic
1052796351 9:32927056-32927078 CCTTCCCTGAAAAAGCTGGCAGG + Intergenic
1052855442 9:33403606-33403628 GATCTGCAGAAAAAGCTGGAAGG - Intergenic
1053378129 9:37625749-37625771 CACCCCCTGAAATAGCTGCAGGG - Intronic
1053683456 9:40499949-40499971 GATCTGCAGAAAAAGCTGGAAGG - Intergenic
1053933435 9:43128264-43128286 GATCTGCAGAAAAAGCTGGAAGG - Intergenic
1054280259 9:63124979-63125001 GATCTGCAGAAAAAGCTGGAAGG + Intergenic
1054394577 9:64639952-64639974 GATCTGCAGAAAAAGCTGGAAGG - Intergenic
1054429226 9:65145151-65145173 GATCTGCAGAAAAAGCTGGAAGG - Intergenic
1054501158 9:65876384-65876406 GATCTGCAGAAAAAGCTGGAAGG + Intergenic
1054898397 9:70339825-70339847 CATCCCCTGAAAAAGGTAGATGG + Intronic
1056129907 9:83574175-83574197 CATCACCTGAAGATCCTGAATGG - Intergenic
1056789645 9:89617264-89617286 CTTCATCTGAAACATCTGGAAGG + Intergenic
1059121831 9:111646814-111646836 CATCAGCTAAAAAGGCTGAATGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1062685973 9:137813677-137813699 CCTCCCGTGAAAGAGCTGGAAGG + Intronic
1188021632 X:25165040-25165062 CATCAGCTGAAAAAGTTAAAAGG - Intergenic
1189904750 X:45746482-45746504 CAAGAGATGAAAAAGCTGGATGG + Intergenic
1189907066 X:45772089-45772111 CCCCACATGAAAAATCTGGAAGG + Intergenic
1192381185 X:70618317-70618339 CATCACCTTCCAAACCTGGAAGG - Intronic
1192843710 X:74883272-74883294 CAGCAACGGAAGAAGCTGGATGG + Intronic
1193675630 X:84448318-84448340 CAGCACCTGAGGAAGCTGGCTGG + Intronic
1196923340 X:120607063-120607085 CATCACAGGAAATACCTGGACGG - Intronic
1198989141 X:142490812-142490834 CCACACTTGTAAAAGCTGGACGG + Intergenic
1199880046 X:151966899-151966921 CCTCACCTGACAATGCTTGAAGG - Intronic
1200254532 X:154572940-154572962 CATCACCAGAAACAGATGGCAGG - Intergenic
1200263237 X:154631468-154631490 CATCACCAGAAACAGATGGCAGG + Intergenic
1200929642 Y:8685455-8685477 CAACACCAGGAAAAGCAGGAGGG + Intergenic
1201283739 Y:12361936-12361958 TCTTAGCTGAAAAAGCTGGATGG - Intergenic