ID: 1130403270

View in Genome Browser
Species Human (GRCh38)
Location 15:83576992-83577014
Sequence CACTTGAACCAAGGAGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181667
Summary {0: 5, 1: 470, 2: 10453, 3: 51683, 4: 119056}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130403270_1130403274 9 Left 1130403270 15:83576992-83577014 CCTCCGTCTCCTTGGTTCAAGTG 0: 5
1: 470
2: 10453
3: 51683
4: 119056
Right 1130403274 15:83577024-83577046 CCTCAGCCTTCTGAGTAGCTAGG 0: 4034
1: 105705
2: 210194
3: 239846
4: 148354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130403270 Original CRISPR CACTTGAACCAAGGAGACGG AGG (reversed) Intronic
Too many off-targets to display for this crispr