ID: 1130403274

View in Genome Browser
Species Human (GRCh38)
Location 15:83577024-83577046
Sequence CCTCAGCCTTCTGAGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708133
Summary {0: 4034, 1: 105705, 2: 210194, 3: 239846, 4: 148354}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130403271_1130403274 6 Left 1130403271 15:83576995-83577017 CCGTCTCCTTGGTTCAAGTGATT 0: 9
1: 1243
2: 20271
3: 63862
4: 99540
Right 1130403274 15:83577024-83577046 CCTCAGCCTTCTGAGTAGCTAGG 0: 4034
1: 105705
2: 210194
3: 239846
4: 148354
1130403272_1130403274 0 Left 1130403272 15:83577001-83577023 CCTTGGTTCAAGTGATTCTCATG 0: 80
1: 5039
2: 69918
3: 142979
4: 169464
Right 1130403274 15:83577024-83577046 CCTCAGCCTTCTGAGTAGCTAGG 0: 4034
1: 105705
2: 210194
3: 239846
4: 148354
1130403270_1130403274 9 Left 1130403270 15:83576992-83577014 CCTCCGTCTCCTTGGTTCAAGTG 0: 5
1: 470
2: 10453
3: 51683
4: 119056
Right 1130403274 15:83577024-83577046 CCTCAGCCTTCTGAGTAGCTAGG 0: 4034
1: 105705
2: 210194
3: 239846
4: 148354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130403274 Original CRISPR CCTCAGCCTTCTGAGTAGCT AGG Intronic
Too many off-targets to display for this crispr