ID: 1130404275

View in Genome Browser
Species Human (GRCh38)
Location 15:83583952-83583974
Sequence GTTTTTGCATAGTTTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 305}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130404272_1130404275 4 Left 1130404272 15:83583925-83583947 CCTGGGCAGCACTAATCTCATTG 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG 0: 1
1: 1
2: 0
3: 22
4: 305
1130404266_1130404275 26 Left 1130404266 15:83583903-83583925 CCCATCACCATGAATGGGGGTCC 0: 1
1: 0
2: 0
3: 9
4: 80
Right 1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG 0: 1
1: 1
2: 0
3: 22
4: 305
1130404267_1130404275 25 Left 1130404267 15:83583904-83583926 CCATCACCATGAATGGGGGTCCC 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG 0: 1
1: 1
2: 0
3: 22
4: 305
1130404271_1130404275 5 Left 1130404271 15:83583924-83583946 CCCTGGGCAGCACTAATCTCATT 0: 1
1: 0
2: 2
3: 14
4: 214
Right 1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG 0: 1
1: 1
2: 0
3: 22
4: 305
1130404270_1130404275 19 Left 1130404270 15:83583910-83583932 CCATGAATGGGGGTCCCTGGGCA 0: 1
1: 0
2: 4
3: 18
4: 197
Right 1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG 0: 1
1: 1
2: 0
3: 22
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130404275 Original CRISPR GTTTTTGCATAGTTTGAGGA TGG Intronic
901776229 1:11562167-11562189 GTTTGTGTACAGTGTGAGGAAGG - Intergenic
903288659 1:22293194-22293216 GTTTTTGCATTTTTTGAGACAGG - Intergenic
904203236 1:28835456-28835478 GTTTTGGCACAGCCTGAGGAAGG - Intronic
904540353 1:31228621-31228643 TTTTTTTCATTGTTTGAGGCTGG + Intronic
905019142 1:34796453-34796475 GTTTGTGCAAAGTCAGAGGAGGG + Intronic
906564377 1:46787909-46787931 GTTTTTTCCTGCTTTGAGGATGG - Intronic
906672921 1:47670565-47670587 GATTTTGTATGGTGTGAGGAAGG + Intergenic
909336052 1:74475313-74475335 GGTGTTGCAGAGTTTGAGGCTGG + Exonic
909554469 1:76938198-76938220 GTTTTTGCATGGTGTGGTGAAGG + Intronic
910684186 1:89899506-89899528 ATTTTTGCAGAGCTTTAGGATGG + Intronic
911002946 1:93185619-93185641 GTTTTTGCATAAGGAGAGGAGGG + Intronic
911246089 1:95519402-95519424 TTTTTAGCCTAGTTTAAGGAAGG + Intergenic
911552423 1:99299656-99299678 CTTTTTGTAAAGTTTGAGGAGGG + Intronic
911986630 1:104634580-104634602 TTTTGTGCATGGTTTGAGGTAGG + Intergenic
915664577 1:157432825-157432847 GTTTTTGCATATCTTGGGCAAGG - Intergenic
916952652 1:169796245-169796267 GTTTTTGAATGTTTTGAGGGTGG - Intronic
918997588 1:191782021-191782043 GAATTTGCATACTTTAAGGACGG + Intergenic
919147046 1:193649064-193649086 GTTTCAGAATAGTTTGAGTAGGG + Intergenic
920221277 1:204403535-204403557 ATTTTTGTATAATTTAAGGAAGG - Exonic
921495394 1:215834514-215834536 GTGTTTGCTTAGTTTTAGGAAGG + Intronic
921823512 1:219644733-219644755 TTTTTAGAATAGTTTGAGTACGG - Intergenic
922012712 1:221607379-221607401 GTTTTTGCATTTGTGGAGGAAGG - Intergenic
922651994 1:227348549-227348571 TATTTTGCATAGGTTGAGCATGG - Intergenic
1063661795 10:8039339-8039361 GTTCTTGAGTAGTTTGAAGAAGG - Intergenic
1063750335 10:8937095-8937117 GTTTGTGTATAGTGTGAGTAGGG + Intergenic
1064880913 10:20052706-20052728 TTTTTTGCATAATTTGTTGACGG - Intronic
1065511438 10:26482340-26482362 GTTCTTGCAACGTTTGAGGGAGG - Intronic
1066119418 10:32269990-32270012 GTTTTTGTATAGGCTCAGGAAGG - Intronic
1066452217 10:35540571-35540593 TTTTTTGAAGAGTTTGTGGAAGG + Intronic
1066534545 10:36376334-36376356 TTTTTGAAATAGTTTGAGGAGGG + Intergenic
1066788214 10:39029607-39029629 GTTTTTGCAGAATTTGTGAAGGG - Intergenic
1066803274 10:39214215-39214237 GTTTTTGTAGAATTTGAGAAGGG - Intergenic
1067949852 10:50723599-50723621 GTTTTTCCGTACTTTTAGGAGGG + Intergenic
1068509657 10:57948359-57948381 TTTTTTGCATGGTGTGAGGTAGG - Intergenic
1068812501 10:61271608-61271630 GTTTTTGTGTACTTTTAGGAGGG - Intergenic
1068899324 10:62249010-62249032 TTTATAGCATAGTTTTAGGATGG - Intronic
1070232108 10:74579453-74579475 GTTTTTGCATTGTTTGAGGAGGG - Intronic
1070853995 10:79591416-79591438 ATTTTTGTATAGTATAAGGAAGG - Intergenic
1070992281 10:80742930-80742952 GTTCTTGTTTAGTTTGAGGCAGG - Intergenic
1072103960 10:92256332-92256354 GTTATTGGAGAGTTTTAGGAAGG - Intronic
1072377580 10:94834049-94834071 TTTTTGGAATAGTTTGAGTAGGG + Intronic
1072390420 10:94979388-94979410 TTTTTGGAATAGTTTGAGTAGGG + Intronic
1073150664 10:101309395-101309417 GGTTTTGTATTGATTGAGGAAGG - Intergenic
1073851996 10:107632371-107632393 GTCTTTCCATATTTTGAGTATGG + Intergenic
1074344444 10:112669256-112669278 ATTTTTTCATAGCCTGAGGAAGG + Intronic
1077788244 11:5408884-5408906 GTTTTTGGTGATTTTGAGGAAGG - Intronic
1077912311 11:6583548-6583570 TTTTTTGAATAGTCTGAGTAGGG - Intronic
1079520385 11:21319636-21319658 GTTTTTGAATAGTTTCCGGCTGG - Intronic
1079753321 11:24225683-24225705 TTATTTGTATAGTATGAGGAGGG + Intergenic
1079952871 11:26826147-26826169 GTTTTTGTATAGTGTGAGGTAGG + Intergenic
1081029252 11:38057237-38057259 ATTTTTGCATGGTATGAGGAAGG + Intergenic
1081330776 11:41797091-41797113 GTTTTTGCATTATTGCAGGATGG - Intergenic
1082291451 11:50378243-50378265 GTTTTTGCATAATATGTGAAGGG + Intergenic
1082291637 11:50381755-50381777 GTTTTTGCAGAGTCTGTGAAGGG + Intergenic
1082592048 11:55023691-55023713 GTTTTTGTACAATCTGAGGAAGG - Intergenic
1084338895 11:68479420-68479442 GATTTTGGATTGTTTGATGAGGG + Intronic
1085131708 11:74045091-74045113 TTTTGTGTATGGTTTGAGGAAGG + Intronic
1086027924 11:82317542-82317564 GTTTTGGTATAGTTTTAGAAGGG - Intergenic
1086614047 11:88793492-88793514 ATTTTTGCATATTCTGAGGAAGG + Intronic
1088033618 11:105283919-105283941 TTTTTTCCATAGTTTCAGGTGGG - Intergenic
1090125322 11:124078058-124078080 TTTTTTTCATAGTTTGAGAGTGG + Intergenic
1090519135 11:127459967-127459989 TTTTTGGCCTAGTTTGAGGGGGG - Intergenic
1090694626 11:129226332-129226354 GTCTTTGGATAGTTTGATTATGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1092349359 12:7743201-7743223 GTTTTTCCATAGTTTTCTGATGG + Intronic
1093563779 12:20577519-20577541 GTTTTTGTATAATTTGAACAAGG + Intronic
1093720172 12:22431921-22431943 TTTTTGGAATAGTTTCAGGAAGG - Intronic
1093725303 12:22500390-22500412 GTTTATGCATACTTTGAGTGTGG - Intronic
1094321781 12:29191621-29191643 GTTTGTGTATACTCTGAGGATGG + Intronic
1094774125 12:33702898-33702920 GTTTTTGGCTATTTTGAGTAAGG - Intergenic
1094864339 12:34511937-34511959 GTTTTTGCAGAATTTGTGAAGGG - Intergenic
1094866215 12:34533964-34533986 GTTTTTGCAGAATCTGAGAAGGG - Intergenic
1095073561 12:37889558-37889580 GTTTTTGCAGATTTTGCGAAGGG - Intergenic
1095077488 12:37949087-37949109 GTTTTTGTAGAATTTGTGGAGGG - Intergenic
1095503414 12:42866027-42866049 GTATTTGCATAGTTGGATAATGG - Intergenic
1095801305 12:46271910-46271932 GTTTTTGTATGGTTCCAGGAAGG + Intergenic
1096566423 12:52485221-52485243 TTTTTGGAATAGTTTGAGAAGGG + Intergenic
1096681101 12:53255745-53255767 GTTTTTTCCTAGTCTGAGTAGGG - Intergenic
1097753844 12:63387365-63387387 GTGTTAGCATGATTTGAGGATGG + Intergenic
1098333374 12:69376750-69376772 TTTTTGGAATAGTTTGAGTAGGG + Intronic
1098425078 12:70354122-70354144 GTTTTTCTCTAGTTTGAGCAGGG + Exonic
1098725113 12:73954646-73954668 CTTTATGAAGAGTTTGAGGAAGG - Intergenic
1100914706 12:99406970-99406992 TTCTTGGCATAGTTTGAGTAAGG - Intronic
1100951689 12:99857623-99857645 CTTTTAGTATAGTTTGAGGTTGG - Intronic
1102102592 12:110292020-110292042 GTTTTGGCTTGGTTTGAAGAAGG + Exonic
1103953826 12:124566147-124566169 CTTTTTGCAGATTTGGAGGAAGG - Intronic
1105273898 13:18903817-18903839 GTTTTTGCGTAGATGGAGAAGGG - Intergenic
1105683365 13:22752336-22752358 GTTTTTGGGTAGTTGGAGGGGGG - Intergenic
1105781999 13:23714055-23714077 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1105803994 13:23938991-23939013 GTTTTTGAATAGATGGAGAAGGG - Intergenic
1105806724 13:23955784-23955806 GTTTTTGGATAGATGGAGAAGGG + Intergenic
1106269959 13:28143114-28143136 GTTTTTGTTTTTTTTGAGGAGGG + Intronic
1107844627 13:44498836-44498858 TGTTTTACTTAGTTTGAGGATGG - Intronic
1107975666 13:45686402-45686424 GCCTTTGCATTGTTTGAGGATGG + Intergenic
1109833275 13:67822801-67822823 TATTTTGCATAGTGTGAAGATGG + Intergenic
1110342168 13:74404251-74404273 GGTTTTGCATAGTTGGAGGTGGG + Intergenic
1110945351 13:81407938-81407960 GTTTTTTCATAGTCAGAGGTGGG - Intergenic
1112645775 13:101330154-101330176 GATTTGGCATAGGGTGAGGAGGG - Intronic
1116484527 14:45431371-45431393 GTTTTAGTATAGTTTGAAGTCGG + Intergenic
1118246088 14:64112427-64112449 CTTTTTCCATATTCTGAGGAAGG + Intronic
1119277556 14:73372609-73372631 GTTTTTTCATTGTTGGAGAAAGG - Intronic
1120067807 14:80064693-80064715 GTTTTTGCATATGGTGAGAAGGG - Intergenic
1120643438 14:87043483-87043505 TTTATTGGATAGTGTGAGGAAGG - Intergenic
1122391111 14:101385292-101385314 ATTTTTGCATTGTTTCAGGCAGG + Intergenic
1202891271 14_KI270722v1_random:160528-160550 TAATTTGCCTAGTTTGAGGATGG + Intergenic
1123802923 15:23840279-23840301 GTTTTTACATGGGCTGAGGAGGG + Intergenic
1124457947 15:29862013-29862035 TTTTGTGTATAGTATGAGGAAGG + Intronic
1125339625 15:38661751-38661773 CATTTTCAATAGTTTGAGGATGG + Intergenic
1125495067 15:40185652-40185674 GTTTTTGGATATTTTGAAGTGGG + Intronic
1126009440 15:44288823-44288845 GTTTTGGCCTGATTTGAGGAGGG + Exonic
1127914224 15:63442119-63442141 GTCTTTGGATAGTGTGAGGTGGG - Intergenic
1129030384 15:72613197-72613219 GTTTTGGAATAGTTTGAGTAAGG + Intergenic
1129209846 15:74062091-74062113 GTTTTGGAATAGTTTGGGTAAGG - Intergenic
1129404180 15:75303314-75303336 GTTTTGGAATAGTTTGGGTAAGG + Intergenic
1130404275 15:83583952-83583974 GTTTTTGCATAGTTTGAGGATGG + Intronic
1130857574 15:87854594-87854616 GTTTTTGCCTAGATAGATGATGG - Intergenic
1136566584 16:31074005-31074027 GGTTTTGCAGAGCTTGAGCATGG - Intronic
1140326864 16:74012857-74012879 GTTTTTTCATCATTGGAGGAAGG - Intergenic
1140544906 16:75798175-75798197 GTTTTTTCATTGTTTTATGAGGG + Intergenic
1143997543 17:11020442-11020464 GTTTTTGAAGAGTTAGAGAAAGG - Intergenic
1145416907 17:22722392-22722414 GTTTTTGTAGAGTTTGAAAAGGG + Intergenic
1146632391 17:34480166-34480188 GTTTTTGCATACATTCAGGAGGG + Intergenic
1146723508 17:35139782-35139804 GTCTTTGCCTGGTTTGGGGAGGG - Intronic
1147734701 17:42628385-42628407 TTTTTGGCATAGTTTGGGGAAGG - Intergenic
1148158936 17:45439148-45439170 GTGTATGCATGGGTTGAGGAGGG - Intronic
1149680183 17:58501042-58501064 AATTCTGCATAGTTTGGGGAAGG + Intronic
1150390290 17:64786237-64786259 GTGTATGCATGGGTTGAGGAGGG - Intergenic
1150545166 17:66149380-66149402 GTTTTTGAAAAGTTTGAAGAGGG + Intronic
1150786969 17:68170808-68170830 ATTTTTGTAGAGGTTGAGGAGGG + Intergenic
1151001567 17:70382626-70382648 GTCTTAGCATAGACTGAGGAGGG - Intergenic
1155726673 18:29094435-29094457 TTTTGTGCATAGTGTGAGGTAGG - Intergenic
1156830921 18:41490274-41490296 GTTTTTGTGTAGTTTTAGAATGG - Intergenic
1159068071 18:63591467-63591489 ATTTTTGCATTGTTTGTAGAAGG - Intronic
1159244595 18:65789490-65789512 TTTTTTGATAAGTTTGAGGATGG + Intronic
1159556898 18:69955307-69955329 GTTTTTGCATAAACTGGGGAAGG - Intronic
1163229674 19:15992749-15992771 CTTTGTGGATAGTTTCAGGAAGG - Intergenic
1163246448 19:16097931-16097953 GTTTTTGCAGAAGTTCAGGATGG - Intronic
1164011802 19:21210090-21210112 GTTTTTGCAAATCTTCAGGAAGG + Intergenic
1164335486 19:24314556-24314578 GTTTTTGTAGAGTTTGTGAAGGG + Intergenic
1164338624 19:24361645-24361667 GTTTTTGTAGAATTTGAGAAGGG + Intergenic
1164338839 19:24364838-24364860 GTTTTTGCAAAATTTGTGAAGGG + Intergenic
1164366797 19:27593003-27593025 GTTTTTGCATAATCTGTGAAGGG + Intergenic
1164367906 19:27607246-27607268 GTTTTTGTATAATCTGAGAAGGG + Intergenic
1166278932 19:41777270-41777292 GTTTTCGCCAATTTTGAGGACGG + Intergenic
1166875974 19:45897559-45897581 GTTTTTGGTTGTTTTGAGGAAGG + Intronic
1202666690 1_KI270708v1_random:127373-127395 TAATTTGCCTAGTTTGAGGATGG + Intergenic
925661143 2:6204234-6204256 GTTTTTGTTTTGTTTGAGTAGGG - Intergenic
925811003 2:7700659-7700681 TTTTGTACATAGTTTAAGGAAGG + Intergenic
927412951 2:22847368-22847390 GTTTGTGCTTGGTATGAGGAAGG + Intergenic
927463252 2:23317772-23317794 GTGTTTGAAGAGTTTGAGAAGGG - Intergenic
930990227 2:57645857-57645879 CTTTTTACATAGTATGAGGTGGG + Intergenic
931222863 2:60304019-60304041 GTTTTTGCCTTGTTTGAACATGG - Intergenic
931875345 2:66506180-66506202 GTTTTAGCAGAGTGTTAGGATGG + Intronic
936005981 2:108888417-108888439 TTTTTGGAATAGTTTCAGGAGGG + Intergenic
936264257 2:110989159-110989181 TTTTGTGTATGGTTTGAGGAAGG + Intronic
936750636 2:115637337-115637359 GCTTTTGAGTAGTTTGAAGAGGG + Intronic
936815183 2:116451830-116451852 AGTTTTGCATAGCTTGGGGATGG + Intergenic
938792657 2:134690675-134690697 GTTTTTTCATAGTTTGCTCAAGG - Intronic
942561298 2:177222476-177222498 GTGTTTTCCTAGTATGAGGATGG - Intronic
945668647 2:212774393-212774415 GAATTTGTATAGTTTGAGAAAGG - Intergenic
946606698 2:221412710-221412732 GTTCCTGCATATTTTGAGGGGGG + Intergenic
946674111 2:222139210-222139232 GTTTTAACATAGACTGAGGATGG + Intergenic
946829327 2:223712008-223712030 GTTTTTGCATTTTATGAGCAAGG - Intergenic
946982619 2:225234214-225234236 GGCTTTGCAGAGCTTGAGGATGG - Intergenic
948309927 2:236977438-236977460 GTTTCTGAATAGCTGGAGGAGGG + Intergenic
948875743 2:240826893-240826915 GTTCTTGGATAGCTTCAGGATGG + Intergenic
949057362 2:241935754-241935776 GTTTATGTATAGTGTGAGGTAGG - Intergenic
1169619883 20:7493450-7493472 GTTTTTGTTTTGTTTGAGGCAGG - Intergenic
1170553469 20:17496430-17496452 GTTTCTGCCTGGTTTGAGGGAGG + Intronic
1173277634 20:41598435-41598457 GCTTTTGTTTAGTTTGCGGACGG - Intronic
1174825268 20:53762828-53762850 ATTTTTGAAGAGTTTGAGGCAGG - Intergenic
1175312260 20:58020035-58020057 GTGTTGGCATGGTGTGAGGATGG + Intergenic
1175652749 20:60740926-60740948 TTTTTTGCATAATGTGAGGCAGG + Intergenic
1177607744 21:23403387-23403409 ATTTTTTCATAGTTTAAGCATGG + Intergenic
1177696109 21:24574049-24574071 ATTTTTACATATTTTGAGTATGG - Intergenic
1180016563 21:45089636-45089658 GTTTTTGTACAGTTTGAAGTTGG + Intronic
1184612993 22:45617679-45617701 ATTTGTGCATAATTTGAGGTAGG + Intergenic
949775576 3:7629000-7629022 ATTATTGCAAAGTTTGAGGATGG - Intronic
951236545 3:20242589-20242611 TTTTTTGAATAGTTTCAGTAGGG - Intergenic
951318326 3:21214270-21214292 ATTTTTGTATAGTGTAAGGAAGG + Intergenic
952797927 3:37259437-37259459 GTTTTTGCCTCATTTGAGCATGG - Intronic
952911341 3:38190341-38190363 GTTTTTTTATAGTTTGTGTAGGG - Intronic
955497417 3:59548872-59548894 GTTTTTGGTTAGCTTGAGGATGG - Intergenic
956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG + Intronic
957089195 3:75712197-75712219 TAATTTGCCTAGTTTGAGGATGG - Intronic
957144427 3:76405122-76405144 GATGTTGAATTGTTTGAGGAAGG + Intronic
957239259 3:77637298-77637320 GTTTTTTATTAGTTTGGGGAAGG + Intronic
957958940 3:87225559-87225581 GTTCTCCCATAGTTTGAAGAAGG - Intergenic
958061518 3:88488866-88488888 GATTTGGCATAGTTTTAAGATGG + Intergenic
958627516 3:96645237-96645259 GTTTTTGCTTAGGTGGAGAAAGG - Intergenic
958724426 3:97887369-97887391 GTTTTTGTTTACTTTGATGATGG + Intronic
959882303 3:111458016-111458038 CTTTTTGAAGAATTTGAGGATGG + Intronic
960484121 3:118229968-118229990 TTTTTTACATATTTTTAGGATGG - Intergenic
960536346 3:118818699-118818721 GATTTTGGACAGTTTGGGGATGG - Intergenic
962169884 3:133089924-133089946 ATTTTTGCATAGTTTGATTCAGG - Intronic
963217195 3:142761622-142761644 ATTTTTGAAGAGTTTGAGTAAGG + Intronic
964239850 3:154579110-154579132 TTTTTCGAATAGTTTGAGTAGGG - Intergenic
965229653 3:166034205-166034227 CTTTTAGTATAGTTTGAGGTAGG + Intergenic
965567755 3:170138762-170138784 GTTTTGGCCTAGGTTGTGGAGGG - Intronic
965908274 3:173738414-173738436 TTTTGTGCATGGTGTGAGGAAGG + Intronic
966274227 3:178145492-178145514 GTACTTGCATAGTTTCAGAAAGG - Intergenic
966417300 3:179702436-179702458 GTTCTGGCATGGTTTGAGGAGGG - Intronic
967638430 3:191832907-191832929 GTATCTGCATAATTTTAGGATGG + Intergenic
970250554 4:14111017-14111039 TTTTATGCAAAGATTGAGGAGGG + Intergenic
972714088 4:41628477-41628499 GAATTTTCTTAGTTTGAGGAAGG - Intronic
972777796 4:42259152-42259174 GTTTGTGCAGAGTATGATGATGG - Intergenic
975450319 4:74518084-74518106 GTTTTTGCCCAGTTTGAGTGAGG + Intergenic
976996929 4:91444898-91444920 GTTTAGCCATAGTGTGAGGAAGG - Intronic
978310882 4:107383799-107383821 GTTCTTGTTTAGTTTGAGGCAGG - Intergenic
978491551 4:109316208-109316230 GCTGTTGCAGGGTTTGAGGAGGG - Intergenic
978886071 4:113767795-113767817 ATTTTTGAATGGTTTGAGGCAGG + Intergenic
979063895 4:116102182-116102204 GTTTATCCATAGATTGAGCATGG + Intergenic
980165971 4:129227950-129227972 TTTTATGCATAGTGTGATGAAGG + Intergenic
980320907 4:131273735-131273757 TTTTTAGCATAGTTTGAAGTTGG - Intergenic
980663460 4:135898202-135898224 GTTTTGGGAGATTTTGAGGAAGG + Intergenic
983923943 4:173376018-173376040 ATTTTTGCACAGATTGAGGGTGG - Intronic
984887850 4:184466678-184466700 GTTGATGCATTGTTTGGGGATGG - Intronic
985005519 4:185531637-185531659 GTATTTGTATAGTGTGAGGCGGG + Intronic
985181199 4:187265521-187265543 CTTTTTGCATAATATGAGGTAGG + Intergenic
987800241 5:22686544-22686566 TTTTTTGAATATTATGAGGAAGG + Intronic
988884163 5:35537087-35537109 ATATTTACATAGTTTGAGGGTGG + Intergenic
989320121 5:40124267-40124289 TTTTTTGAAAAGGTTGAGGATGG - Intergenic
989834007 5:45960922-45960944 GTTTTTGCAGAATTTGAGCAGGG + Intergenic
989837762 5:46015188-46015210 GTTTTTGTATAATCTGTGGAGGG + Intergenic
989838363 5:46025724-46025746 GTTTTTGCAGAATCTGAGAAGGG + Intergenic
989841750 5:46083053-46083075 GTTTTTGTAGAGTCTGTGGAGGG + Intergenic
990281539 5:54256512-54256534 CTTTTGGCATAGTTTCAGTAGGG - Intronic
990661222 5:58017569-58017591 CTTTTTGCATCTTTTGATGAGGG + Intergenic
990890190 5:60640362-60640384 TTTTTTGCATATTTTTAAGAAGG - Intronic
991402655 5:66270343-66270365 GTTTTAGCATAGTGTGTGGTGGG + Intergenic
993320252 5:86461743-86461765 GGATTTGCATAGCTTGAGCATGG - Intergenic
993881553 5:93368184-93368206 ATTTGTGCCTAGTGTGAGGAAGG + Intergenic
994889294 5:105609109-105609131 TTTTTGGAATAGTTTGAGTAGGG - Intergenic
995305000 5:110635277-110635299 TTTTGGGAATAGTTTGAGGAGGG - Intronic
995433401 5:112107954-112107976 GTTTTGGCAGAGGTAGAGGAAGG - Intergenic
995697013 5:114890619-114890641 TTTTTGGAATAGTTTGAAGATGG + Intergenic
995813554 5:116138586-116138608 ATTTGTGCATCTTTTGAGGAAGG + Intronic
996121322 5:119675930-119675952 GTTTATGCATACTTTATGGAAGG + Intergenic
996331179 5:122330734-122330756 ATTTTTCCATAGTTGGGGGAGGG + Intronic
996659556 5:125985019-125985041 TTTTTGGAATAGTTTGAGTAGGG + Intergenic
996890823 5:128417524-128417546 TTCTATGCATAGTTTGTGGAGGG + Intronic
997025877 5:130060381-130060403 GTCTATGCATAGTTTGTTGAGGG - Intronic
997083784 5:130772157-130772179 GTTTTTCCTTAGTCTGAGGTAGG + Intergenic
998638851 5:143986928-143986950 GTTATTGTACAGATTGAGGAAGG - Intergenic
999957231 5:156715971-156715993 GTCTTTGCATGGTTTGAAGCAGG + Intronic
1000241730 5:159414954-159414976 GCTTTGGCATTGGTTGAGGATGG - Intergenic
1000606445 5:163332480-163332502 GTTTTAGCATAGCCTGAAGATGG - Intergenic
1002490530 5:179572936-179572958 GTTTTGGCATAGTGTGAAGTAGG + Intronic
1003143959 6:3494123-3494145 TTTCTTCCATAGTTTCAGGAGGG - Intergenic
1003376793 6:5586751-5586773 TTTTTGGGATAGTTTGAGAAGGG + Intronic
1004023361 6:11795108-11795130 ATTTTCACACAGTTTGAGGATGG - Intronic
1005273686 6:24193502-24193524 GTTCTTGCAGAGTTTGGAGATGG + Intronic
1006464336 6:34182735-34182757 GTTTTTACATAGTGAGATGATGG - Intergenic
1008480397 6:51979777-51979799 CTTTTGGTATAGCTTGAGGATGG - Intronic
1009775499 6:68200501-68200523 GTTATTGTATAGTTTGAAGTTGG - Intergenic
1010677847 6:78765167-78765189 TTTTTGGAATAGTTTGAGTAGGG - Intergenic
1012459382 6:99443806-99443828 ATTTTAGCAGAGTTTTAGGAAGG - Intronic
1014052631 6:116973551-116973573 TTTTTGGCATAGTGTGTGGATGG - Intergenic
1014880999 6:126724311-126724333 GATTTAAAATAGTTTGAGGAAGG - Intergenic
1014901902 6:126976064-126976086 GTTTTTGCAAAGTTAGAAAATGG - Intergenic
1017560118 6:155617902-155617924 TTTTGTGTATGGTTTGAGGAAGG + Intergenic
1018131084 6:160733040-160733062 GTTCTTGGATAGTCTCAGGATGG - Intronic
1018316993 6:162566726-162566748 CTTTTGGAATAGTTTGAGTAGGG - Intronic
1018755015 6:166841490-166841512 GTTTTTTCAAAGTTATAGGAGGG + Intronic
1022052468 7:26691216-26691238 TTCTTTGCATAATTTGGGGAAGG - Intronic
1024324796 7:48101203-48101225 GTTTTTAAAGAGTTTGAAGATGG - Intronic
1024776955 7:52798821-52798843 TTTTTGGCATAGCTTTAGGATGG - Intergenic
1025005661 7:55352738-55352760 GGTTTTACATAGTTTTAGGGAGG + Intergenic
1025523124 7:61766586-61766608 GTTTTTGTATAATCTGAGAAGGG - Intergenic
1025530867 7:61881489-61881511 GTTTTTGTATAATTTGTGAAGGG - Intergenic
1025546876 7:62185615-62185637 GTTTTTGTATAATCTGAGAAGGG - Intergenic
1025577382 7:62665430-62665452 GTTTTTGTATAATTTGTGAAGGG - Intergenic
1025600432 7:62990436-62990458 GTTTTTGTATAATTTGTGAAGGG + Intergenic
1026183096 7:68059525-68059547 TTCTTTGCTTAGTTTTAGGATGG + Intergenic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1030777697 7:113554975-113554997 TTTTGTGCATAGTTTGAGATAGG - Intergenic
1031825882 7:126564672-126564694 TTTTTGGAATAGTTTGAGAAGGG - Intronic
1031921092 7:127601082-127601104 GTATTTGCAGGGTTTGATGAAGG - Intronic
1031984117 7:128151468-128151490 GTATTTTCTTAGTTTAAGGATGG + Intergenic
1032964667 7:137082038-137082060 TTTTCTGCAAAGTTTGAGGCTGG - Intergenic
1034705668 7:153140900-153140922 CTTTTAGTATAGTTTGAGGTTGG + Intergenic
1035172991 7:157030395-157030417 GTTTTATAATAGTTTGGGGAAGG - Intergenic
1036562444 8:9908112-9908134 GGTTTTGTTTAGATTGAGGACGG + Intergenic
1037093181 8:14947991-14948013 ATTTTTGCATTGTTTGAAGAAGG + Intronic
1039184452 8:34900944-34900966 ATTCTTGGATAGTTTGATGATGG + Intergenic
1040291125 8:46125385-46125407 GCATTTGCATAGCTTGAGCATGG - Intergenic
1040344542 8:46476998-46477020 GTTTTTGTAGAATTTGTGGAGGG - Intergenic
1041823561 8:62066357-62066379 TTTTCTGAATAGTTTGAGTAGGG - Intergenic
1044025057 8:87158974-87158996 GTTTTTATACAATTTGAGGAAGG + Intronic
1044715352 8:95094928-95094950 TTTTTTGCAGAGTTTGGGGGTGG + Intronic
1045392544 8:101729921-101729943 GTATTTCCATATTTGGAGGAGGG - Intronic
1046923817 8:119765415-119765437 GTTTTTCAATAGGTAGAGGAAGG + Intronic
1046924173 8:119768442-119768464 GTTTTTCAATAGGTAGAGGAAGG - Intronic
1047029658 8:120862513-120862535 GGGTTTGCATAGTGTGAGAAGGG - Intergenic
1047135387 8:122072083-122072105 GTTTTTGCATATTTGGATTATGG - Intergenic
1049547449 8:143239942-143239964 GTTTTAGGATGGTTTTAGGATGG + Intergenic
1052302765 9:26972710-26972732 GTTCTTGCTTAGTTTGAGGCAGG + Intronic
1052403803 9:28033609-28033631 GTTTTTTTATATTTTGAGGATGG + Intronic
1053099479 9:35359014-35359036 TTTTGTGCATAGTATGAGGTAGG + Intronic
1054858929 9:69930064-69930086 GTCCTTGCTTAGTTTGAGGCAGG + Intergenic
1056504047 9:87239839-87239861 GTCTTTGCTGAGTTTGAGAATGG + Intergenic
1056609068 9:88113214-88113236 GTTTTGGGATAGTTGGAGGGGGG - Intergenic
1058009944 9:99965846-99965868 GTGTTTGCAAAGTGTGAGGGGGG - Intronic
1060694854 9:125699917-125699939 GATTTTGAATATTTTGAGTAGGG + Intronic
1061090638 9:128424126-128424148 GTGTCTGCAAACTTTGAGGAGGG - Exonic
1186788982 X:12978614-12978636 GTCTTTGCATTGTTTGAAAAAGG - Intergenic
1188013245 X:25079726-25079748 GAATTTGCCTAATTTGAGGATGG + Intergenic
1189266751 X:39722662-39722684 GTTTTTTCAGAGTTGGGGGAGGG - Intergenic
1189744160 X:44153095-44153117 GTTTTTGTATTTTTTGAGCAAGG + Intronic
1189989217 X:46578581-46578603 TTTTTTGCAAAGATTGGGGATGG + Intronic
1190441600 X:50480329-50480351 GCTCTTGGATAGTTTCAGGATGG - Intergenic
1191263153 X:58351238-58351260 GTTTTTGTATAGTCTGCGAAGGG + Intergenic
1191267628 X:58416293-58416315 GTTTTTGTAGAATCTGAGGATGG - Intergenic
1191578600 X:62735115-62735137 CTTTTTGTATAGTCTGAGAAGGG - Intergenic
1191811436 X:65193210-65193232 TTTTTGGAATAGTTTAAGGAGGG + Intergenic
1191934415 X:66411070-66411092 GTTTTTGAATGCTCTGAGGATGG - Intergenic
1192681940 X:73261720-73261742 GTTTTTGTTTAGTTTGGGGCAGG + Intergenic
1193079021 X:77386998-77387020 TTTTTGGAATAGTTTGAGGAGGG - Intergenic
1194377958 X:93159320-93159342 GTTATTGTACAGTTTGAAGATGG + Intergenic
1194840773 X:98738562-98738584 GTGTGTGCATATTTTGGGGAGGG - Intergenic
1195499654 X:105580375-105580397 TTTTTTGCATACTTTGGTGAAGG + Intronic
1196507974 X:116471636-116471658 TTTTTGGAATAGTTTGAGTAGGG + Intergenic
1197018316 X:121654873-121654895 GTTTGTGCATAGTGTGAGGTTGG + Intergenic
1198721037 X:139620951-139620973 GTTTTGGTATAGTTTGATGTCGG - Intronic
1198982280 X:142412496-142412518 TTTTTGGAATAGTTTGAGAAGGG - Intergenic
1199114347 X:143972919-143972941 TTTTTGGAATAGTTTGAGTAGGG + Intergenic
1199193872 X:145004131-145004153 GTTTTTGCCTAGTTCTAGGATGG - Intergenic
1200328429 X:155267038-155267060 TTTTATGCATGGTGTGAGGAAGG + Intergenic
1200359371 X:155586957-155586979 TTTTTAGAATAGTTTCAGGAGGG - Intronic