ID: 1130405662

View in Genome Browser
Species Human (GRCh38)
Location 15:83598714-83598736
Sequence GTAGCTTATCTCCTTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130405662_1130405664 22 Left 1130405662 15:83598714-83598736 CCAATTTCAAGGAGATAAGCTAC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1130405664 15:83598759-83598781 AATGTTCAATTTTAACAGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 299
1130405662_1130405665 27 Left 1130405662 15:83598714-83598736 CCAATTTCAAGGAGATAAGCTAC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1130405665 15:83598764-83598786 TCAATTTTAACAGAGAGGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 260
1130405662_1130405663 -10 Left 1130405662 15:83598714-83598736 CCAATTTCAAGGAGATAAGCTAC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1130405663 15:83598727-83598749 GATAAGCTACAGTTTTGTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130405662 Original CRISPR GTAGCTTATCTCCTTGAAAT TGG (reversed) Intronic
909154445 1:72054437-72054459 GTAGCTTATAGACTTGAGATAGG - Intronic
910065381 1:83144471-83144493 CTGTCTTCTCTCCTTGAAATTGG + Intergenic
910201832 1:84708000-84708022 GTAGGTTATGTCCTTTAACTTGG + Intergenic
912090774 1:106072624-106072646 GGACCTTAACTCCTTGAAGTTGG - Intergenic
912869664 1:113292411-113292433 GAACATTTTCTCCTTGAAATTGG - Intergenic
918764011 1:188455312-188455334 ATAGCTAATCTCCTTTACATGGG + Intergenic
924716522 1:246580102-246580124 GGGGCTTATCTTCTTGAAAGTGG + Intronic
1063255652 10:4324652-4324674 GTGGCTTATGTCCCTGAAAGTGG + Intergenic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1066478198 10:35768880-35768902 GTAGCTTCTCACCTTCACATAGG - Intergenic
1067009437 10:42696097-42696119 ATGGCTTATCTCCTTTATATTGG - Intergenic
1067314280 10:45147154-45147176 ATGGCTTATCTCCTTTACATTGG + Intergenic
1068149369 10:53112486-53112508 GTAGCTAAAATCCTTGAAAAAGG + Intergenic
1068161156 10:53266197-53266219 GTAGCTTTTCTCCCTGACTTGGG + Intergenic
1069333495 10:67321164-67321186 TTATCTTCTCTCTTTGAAATTGG - Intronic
1076119365 10:127923203-127923225 TTGGATTATCTCTTTGAAATTGG - Intronic
1079288055 11:19157866-19157888 GTTGCTTTCCTCCATGAAATTGG - Intronic
1079527010 11:21402940-21402962 CTAGCTGACCTCCTTGATATTGG + Intronic
1086356281 11:86004001-86004023 GGAGTTTATCACCTTGAAAATGG + Intronic
1086583969 11:88431118-88431140 GTAGCTCATCTCACTGAAGTGGG + Intergenic
1087430690 11:98050169-98050191 TTAGCTTATGTCCTTGGAAATGG + Intergenic
1097215356 12:57407319-57407341 GTAGCTTATATGTTTAAAATAGG - Intronic
1098645208 12:72892017-72892039 GTATCTCATCTGCTTGTAATTGG + Intergenic
1099630079 12:85131468-85131490 GTAGCTCATATCCTTTAAGTGGG - Intronic
1100860656 12:98802647-98802669 GAAGCTTTTCTCCTTGAGATGGG + Intronic
1103314139 12:120038728-120038750 GTAAGTTATCTCCCTAAAATAGG - Intronic
1107066464 13:36218720-36218742 GAAGCTTCTCTCCTTGAAGGTGG - Intronic
1110128080 13:71973322-71973344 TTAGCTTAAATCTTTGAAATTGG + Intergenic
1111121198 13:83852506-83852528 GAAGCTTATGTTTTTGAAATTGG + Intergenic
1113987608 13:114330997-114331019 GTCGGTTATCTCCATGAAAGTGG - Intergenic
1120216643 14:81687768-81687790 GTGGCTTTTCTTTTTGAAATGGG - Intergenic
1120252256 14:82072547-82072569 GTTGCTTAGCTACATGAAATGGG + Intergenic
1120293849 14:82613037-82613059 GTTGCTTAGCTCCTTGACAATGG + Intergenic
1126174253 15:45721081-45721103 GTAGCTCTTCTCAGTGAAATAGG + Intergenic
1130156198 15:81352132-81352154 CTAGCTTCACTACTTGAAATTGG + Intronic
1130405662 15:83598714-83598736 GTAGCTTATCTCCTTGAAATTGG - Intronic
1131675317 15:94665223-94665245 GTCGCTTATCATCTTGAAAAGGG + Intergenic
1133414863 16:5598669-5598691 GTGGCTAGTCTCATTGAAATGGG - Intergenic
1134779708 16:16884694-16884716 TTAACTTATCTCTTTGAAAATGG + Intergenic
1138930968 16:61655523-61655545 GAAGCTTATGTCCTTCCAATTGG - Exonic
1140187254 16:72786445-72786467 TTAACTTTTCCCCTTGAAATTGG + Exonic
1143966570 17:10759750-10759772 TCAGCTTATCTCCTTGGAATAGG + Intergenic
1144013352 17:11171065-11171087 GTTGCTTATCTCTTTGATCTGGG + Intergenic
1145115404 17:20205480-20205502 GTAGCTTCTCTCTTTCAAAGCGG - Exonic
1146484307 17:33230850-33230872 GTTGCGTATCACCTTGAAGTGGG - Intronic
1157344301 18:46810055-46810077 GAAGTTTATCATCTTGAAATTGG - Exonic
1157520982 18:48345363-48345385 GTAGCTGATAGCCCTGAAATAGG - Intronic
1157949881 18:52024264-52024286 GCAGCTTATAGCCTGGAAATGGG + Intergenic
931670130 2:64640333-64640355 GTGTCTTTTCTCCTTTAAATTGG - Intronic
940600670 2:155855411-155855433 TTAGGTTTTCTCCGTGAAATGGG - Intergenic
941101832 2:161305291-161305313 GTGGCTTTTCTTCTTGAAAGTGG + Intergenic
942080618 2:172396448-172396470 GCATCTTCTCTCCTTGAGATGGG - Intergenic
945751337 2:213788298-213788320 GTAGCTTATTTCCTTTTTATAGG - Intronic
945855722 2:215067546-215067568 ATAGCTTTTCTCCTGGAGATGGG - Intronic
947283695 2:228485176-228485198 GTAGTTTATTTCTTTGATATCGG - Intergenic
947884795 2:233559482-233559504 GTAGGTAATCTCCATGTAATCGG + Intronic
1172539660 20:35701210-35701232 GTAGTTTTTCTCCTTTAAAATGG - Intergenic
1173577069 20:44119418-44119440 GTAGCTTTTCTCATTGTAGTGGG + Intronic
1179157833 21:38865379-38865401 GAAGCTTCTCTCCCTGAATTAGG - Intergenic
949641127 3:6036727-6036749 GTGGCTCATCTCATTGAAACTGG - Intergenic
957834572 3:85570423-85570445 TTAGCTCATCTCCTTAAAAATGG - Intronic
957983959 3:87548390-87548412 GTTGATTATCTCCTGGATATGGG + Intergenic
960098756 3:113715540-113715562 GTAGCTTATCTCATTCTAAATGG - Intergenic
960419727 3:117429018-117429040 TTAGCTTTTCTCCTTAAATTTGG - Intergenic
964069492 3:152614500-152614522 GTAGCTGATCTCCATGAAGAGGG - Intergenic
966308528 3:178565996-178566018 GTAACTTATCTCTTTGAATCAGG + Intronic
967466810 3:189816057-189816079 GTAACTTAACTCCTTAAAATTGG + Intronic
967803118 3:193686419-193686441 GTAGATTTTTTCCTTGAAATAGG - Intronic
969961217 4:10946602-10946624 GTAGCTTCACTCCTTGAAGCAGG + Intergenic
971056235 4:22915794-22915816 GTGTCTGATCTCCTTCAAATGGG + Intergenic
975135528 4:70870498-70870520 CTGGCTTATCTCCTTGATGTGGG - Intergenic
977481856 4:97588393-97588415 ATAGTTTATCTCCTTCCAATTGG - Intronic
980620763 4:135299884-135299906 GTAGTTTAACAGCTTGAAATTGG + Intergenic
980781327 4:137495855-137495877 ATAGCTGATTTCCATGAAATAGG + Intergenic
981405840 4:144367690-144367712 GTAGCTTATCTCCTTAAGCAAGG - Intergenic
981497167 4:145407165-145407187 GTCAGTTATTTCCTTGAAATAGG + Intergenic
982590547 4:157303802-157303824 GTATCTCATCTCTTTGTAATGGG + Intronic
985232820 4:187839573-187839595 GAATCTTATCTCCAAGAAATGGG + Intergenic
988033322 5:25794350-25794372 ATATCTTATCTTCTTGTAATAGG - Intergenic
990086940 5:51990189-51990211 GTTGATTCTTTCCTTGAAATTGG + Intergenic
996384056 5:122891907-122891929 TTTGCTTCTCTCATTGAAATAGG + Intronic
997865342 5:137457594-137457616 TTAGCTTATCTCATTGAAAGAGG - Intronic
1000474966 5:161695687-161695709 GTAGCTTCTCTTCTTTACATGGG + Intronic
1000626989 5:163550072-163550094 CTAGGTAATGTCCTTGAAATGGG + Intergenic
1002174310 5:177392951-177392973 GTGGCTTTTCTCATAGAAATTGG + Intronic
1003248228 6:4402047-4402069 GGAGCTGAGCTCCTTGCAATGGG + Intergenic
1005849131 6:29806006-29806028 TTAGCTTATCTCCTCAAAAGTGG - Intergenic
1012013300 6:93821322-93821344 GTAGTTTATTTTCTTTAAATTGG + Intergenic
1012858751 6:104533723-104533745 GGAGCTCATCTCATTGAACTTGG + Intergenic
1017582095 6:155877645-155877667 TTAGCATATTTCCTTCAAATTGG - Intergenic
1020822414 7:12987373-12987395 GTAGCCAAACTCCTTGAAAAAGG + Intergenic
1021932337 7:25594135-25594157 ATAGCTTATCTTCTTGAATATGG + Intergenic
1023191774 7:37590836-37590858 TTCCCTTATCTCCTTGAATTTGG - Intergenic
1027278726 7:76590277-76590299 CTGTCTTCTCTCCTTGAAATTGG - Intergenic
1032434427 7:131888459-131888481 GTAGGTTATCTTCTAGAGATGGG + Intergenic
1032572780 7:133018680-133018702 TTAAATTATCTCTTTGAAATTGG - Intronic
1033322361 7:140351306-140351328 GAAGCTTATCGCCTTGACTTGGG + Exonic
1033892348 7:146030468-146030490 GTAGATTATCTAGTTGAAAATGG - Intergenic
1038382368 8:27108118-27108140 GCTGCTTTTCTCCTTGAAGTTGG - Intergenic
1038904580 8:31885022-31885044 GTTGCTTATTTACTTGAAACTGG - Intronic
1038951644 8:32421415-32421437 GGAGCTTCTCTCTTTCAAATGGG + Intronic
1047772621 8:128042526-128042548 GTAGCTGATCCACTTGACATTGG - Intergenic
1050244580 9:3674959-3674981 GTAGCTCATCTCCTAGAAGAAGG - Intergenic
1055431966 9:76253050-76253072 GCAGTTTGTCTCCTTTAAATTGG + Intronic
1058579380 9:106438517-106438539 GTAGCTTTTTTCCTTCAGATTGG - Intergenic
1187013437 X:15302954-15302976 GTAGCTTGTCTCCCTGAAAGTGG - Intronic
1189789054 X:44586004-44586026 GTAGATTTTCTACTTGGAATGGG + Intergenic
1194509933 X:94781873-94781895 GTAGCCGAACTCCTTGAATTTGG - Intergenic
1200146092 X:153927100-153927122 GCAGCTTTTCTCCGGGAAATCGG + Intronic
1201516029 Y:14819457-14819479 CTACCTTATCTGCTTTAAATTGG + Intronic