ID: 1130411989

View in Genome Browser
Species Human (GRCh38)
Location 15:83654839-83654861
Sequence CAGCCAGGAGTCGCCGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 232}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130411983_1130411989 -3 Left 1130411983 15:83654819-83654841 CCGCACTGGCCGCCTCCCTTCAG 0: 1
1: 0
2: 2
3: 31
4: 299
Right 1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 232
1130411982_1130411989 -2 Left 1130411982 15:83654818-83654840 CCCGCACTGGCCGCCTCCCTTCA 0: 1
1: 0
2: 1
3: 25
4: 285
Right 1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 232
1130411980_1130411989 5 Left 1130411980 15:83654811-83654833 CCAGGGCCCCGCACTGGCCGCCT 0: 1
1: 0
2: 2
3: 37
4: 319
Right 1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 232
1130411981_1130411989 -1 Left 1130411981 15:83654817-83654839 CCCCGCACTGGCCGCCTCCCTTC 0: 1
1: 0
2: 0
3: 16
4: 248
Right 1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 232
1130411979_1130411989 6 Left 1130411979 15:83654810-83654832 CCCAGGGCCCCGCACTGGCCGCC 0: 1
1: 0
2: 2
3: 29
4: 286
Right 1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130411989 Original CRISPR CAGCCAGGAGTCGCCGCCTC AGG Intronic
900506405 1:3031724-3031746 GAGCCAGGAATGGCCACCTCTGG - Intergenic
901151590 1:7106949-7106971 CAGACTGGAGTGGCAGCCTCTGG + Intronic
901832876 1:11904355-11904377 CAGGCATGAGTCACCGCGTCTGG - Intergenic
903154036 1:21431728-21431750 CTGCCAGCTGCCGCCGCCTCTGG - Intergenic
906625299 1:47320101-47320123 CAGGCGTGAGTCACCGCCTCTGG - Intergenic
908581745 1:65524556-65524578 GAGCCGGGAGTCGTCGCTTCTGG + Intronic
910758880 1:90716904-90716926 CAGCCAGCAGCCGCCGCCGCCGG - Exonic
918309406 1:183275024-183275046 CAGCCAGGAGTTCCTGCCCCAGG + Intronic
919826565 1:201507291-201507313 GGGGCAGGAGTCGCCGACTCTGG + Exonic
920140004 1:203803466-203803488 CAGGCATGAGCCACCGCCTCTGG + Intronic
920177296 1:204110107-204110129 CAGGCATGAGCCGCCGCGTCTGG + Intronic
920506540 1:206519056-206519078 CTGACAGGAGTCCCGGCCTCGGG + Intronic
920689148 1:208132360-208132382 CAGCCAGGGGGCGCTGTCTCAGG + Intronic
921189770 1:212699393-212699415 CAGCCAGGCGTCGGCGCCCTCGG + Intronic
922213108 1:223500356-223500378 CAGCCAGGGACCGCCTCCTCTGG - Intergenic
922770121 1:228177116-228177138 CAGCCAGGAGTGGGTGCCTGTGG + Exonic
924141255 1:241026308-241026330 CAGGCAGGAGTCACCGCACCCGG - Intronic
1065617453 10:27543009-27543031 CAGGCATGAGTCACCGCATCTGG + Intergenic
1067472953 10:46549419-46549441 CAGCCCGCAGTGGCCCCCTCCGG + Exonic
1069562417 10:69440017-69440039 CAGCCTGGAGTCTCCTCATCTGG + Intergenic
1071178310 10:82953692-82953714 CAGGCATGAGTCACCGCGTCTGG - Intronic
1072046003 10:91655835-91655857 CAGGCATGAGTCACCGCCCCTGG - Intergenic
1074566996 10:114588780-114588802 CAGGCATGAGTCACCGCGTCTGG + Intronic
1074829510 10:117239193-117239215 CAGCCCGGCGTTCCCGCCTCCGG - Intergenic
1076259031 10:129051052-129051074 CAGCCATGATTCTCAGCCTCAGG + Intergenic
1076741722 10:132489013-132489035 CAGCCAGGTGACCCCGCCTAGGG + Intergenic
1077358677 11:2130196-2130218 CAGCCAGGAGCCCCCTCCTGTGG + Intronic
1077368364 11:2170400-2170422 CAGCCAGGAGCGGGCGCCTGCGG - Intronic
1077438293 11:2555507-2555529 CAGCCAGGCGTGGGCGTCTCCGG + Intronic
1077976331 11:7252102-7252124 CAGCTCAGAGCCGCCGCCTCCGG - Exonic
1078371641 11:10751347-10751369 CAGCCGGTAGTCTCCGCTTCAGG - Exonic
1079095131 11:17505092-17505114 CAGCCAGTGGTCGGCACCTCTGG + Intronic
1084943257 11:72625567-72625589 CAGCCTGGTGTCCCCTCCTCAGG - Intronic
1085651060 11:78269137-78269159 CAGACAGCAGCCTCCGCCTCTGG + Intronic
1089480898 11:118804206-118804228 CAGGCATGAGTCGCCGCACCTGG + Intergenic
1089713737 11:120336522-120336544 CGGGGAGGAGCCGCCGCCTCTGG + Intergenic
1090197228 11:124827045-124827067 CAGGCATGAGCCACCGCCTCTGG + Intergenic
1094536941 12:31329725-31329747 CAGGCAGGAGCCACCGCGTCCGG - Intergenic
1095038480 12:37419335-37419357 CACCCAGGAGTCCTCTCCTCAGG + Intergenic
1102271241 12:111537305-111537327 CAGCCATGAGCCACCGCATCTGG - Intronic
1103527536 12:121578428-121578450 CAGCCAGGCGGCGGCACCTCAGG + Intronic
1103558906 12:121781898-121781920 GAGCCAGGCGTCACGGCCTCCGG - Exonic
1104109912 12:125695269-125695291 CAGCCAGGAGGGGCTGCCTTAGG - Intergenic
1105405475 13:20128772-20128794 CAGCCAGGTGGCGCCGATTCCGG + Intergenic
1106067453 13:26369152-26369174 CAGCCATGAGCTGCCGCCCCTGG - Intronic
1109394873 13:61743718-61743740 CAGCTAAGAGTCTCAGCCTCTGG - Intergenic
1109511325 13:63378636-63378658 CAGTCATGAGTCACCACCTCTGG + Intergenic
1112328282 13:98458558-98458580 CAAACACGAGTGGCCGCCTCGGG - Intronic
1113164581 13:107424414-107424436 CAGGCAGGAGCCACCGCCCCTGG + Intronic
1116903931 14:50387242-50387264 CAGGCATGAGTCACCGCATCAGG - Intronic
1116958050 14:50944107-50944129 CAGCCCGGAGTCGGAGTCTCCGG - Intronic
1117293752 14:54359985-54360007 CAGGCATGAGCCACCGCCTCCGG - Intergenic
1118113269 14:62747054-62747076 CAGGCATGAGCCGCCGCGTCCGG - Intronic
1119753430 14:77097731-77097753 CAGCCTGGAGTCGCCGTGACAGG - Intergenic
1122152155 14:99731150-99731172 CTGCCAGGAGGGGCCGGCTCAGG - Intergenic
1122264832 14:100541696-100541718 CAGCCAGGAGTGGCTGCCACTGG + Intronic
1122874794 14:104659133-104659155 CCGCCTGGAGTCACCTCCTCTGG - Intergenic
1124972046 15:34496870-34496892 AAGCCAGGCGTCGCCCCCTCGGG + Intergenic
1127215066 15:56815531-56815553 CAGGCATGAGTCACCGCATCCGG - Intronic
1127420752 15:58803537-58803559 TAGGCAGGAGTCACCGCATCTGG - Intronic
1128020026 15:64382111-64382133 CAGCCATGAGTCCCCGCTCCTGG - Intronic
1128745791 15:70113407-70113429 CAGCCAGGAGCTGGGGCCTCAGG - Intergenic
1130069083 15:80631219-80631241 CAGCCAGGAGTTGCCACATGTGG + Intergenic
1130147519 15:81285612-81285634 CAGCCAGGAGTGGGCCCCTGGGG + Intronic
1130411989 15:83654839-83654861 CAGCCAGGAGTCGCCGCCTCAGG + Intronic
1131178833 15:90226616-90226638 CAGCCATGAGCCACCGCGTCTGG + Intronic
1132009039 15:98258082-98258104 CAGGCATGAGCCACCGCCTCCGG - Intergenic
1133225173 16:4337450-4337472 CAGCCAGGGGCCAACGCCTCTGG - Exonic
1134171879 16:11975869-11975891 CAGGCATGAGTCACCGCGTCCGG + Intronic
1135397816 16:22144637-22144659 CAGGCAGGAGTCACCGCACCTGG - Intronic
1138179837 16:54933540-54933562 CAGCCGGGCGTCGCCGGCCCCGG + Exonic
1141378239 16:83551342-83551364 CAGGCATGAGTCACCGCCCCTGG + Intronic
1141958682 16:87390715-87390737 CAGGCATGAGTCGCCGCACCTGG + Intronic
1142013769 16:87732371-87732393 CAGGCATGAGCCACCGCCTCTGG + Intronic
1142158513 16:88545034-88545056 CAGGCATGAGTCGCCGCACCTGG + Intergenic
1142274740 16:89112021-89112043 GAGCCAGGAGCCTCCGCCACGGG + Intronic
1142346259 16:89555932-89555954 CAGCCAGCAGCAGCCGCCTCTGG + Intronic
1142864185 17:2780326-2780348 CAGGCGGGAGCCGCCGCCTCTGG + Intronic
1142932274 17:3296994-3297016 CAGCCAGTAGCTGCCCCCTCTGG + Intergenic
1142953591 17:3504834-3504856 CAGGCAGGAGCCGCCGCACCAGG + Intronic
1142980390 17:3668115-3668137 CGTCCATGAGTCGCAGCCTCTGG - Intronic
1143009641 17:3858865-3858887 CAGTCATGAGTCCCAGCCTCTGG - Intergenic
1143054796 17:4154824-4154846 CAGCCAGGGGCAGCCGGCTCTGG + Exonic
1144639920 17:16931544-16931566 CAGCCTGGAGCCGGCCCCTCAGG - Intronic
1144733949 17:17544539-17544561 CAGGCAGGAGCCACCGCATCCGG + Intronic
1144995832 17:19267816-19267838 CAGGCAGGAGCCACCGCGTCCGG + Intronic
1146792953 17:35763153-35763175 CAGCCACGAGCCGCCTCCCCTGG - Intronic
1147355707 17:39894641-39894663 CAGGCAGGAGCCGCCGCGCCTGG + Intergenic
1147720335 17:42536145-42536167 GGGCCAGGAGTCGCGGCTTCCGG - Intergenic
1149596119 17:57865688-57865710 CAGCCAGAAACCGCTGCCTCAGG + Intronic
1149704179 17:58680462-58680484 CAGGCAGGAGTCACAGCGTCCGG - Intronic
1149746245 17:59101539-59101561 CAGGCATGAGCCGCTGCCTCTGG - Intronic
1151802334 17:76385567-76385589 AAGGCAGGAGCCGCCGCCACGGG + Exonic
1152184857 17:78849178-78849200 CAGGCAGGAGTCACCGCACCCGG + Intergenic
1152464412 17:80457813-80457835 CTGCCTGGAGCCTCCGCCTCAGG + Intergenic
1152784397 17:82240432-82240454 CACCCAGGGGTTGCCGCCTCTGG + Intronic
1153840086 18:8999616-8999638 CAGGCATGAGTCACCGCATCTGG - Intergenic
1155066803 18:22275271-22275293 CAGGCAGGAGCCACCGCATCTGG - Intergenic
1156353528 18:36321971-36321993 CAGCCAGGTGGCCCTGCCTCTGG - Intronic
1157686419 18:49646155-49646177 CAGCCAGGACTCGCTTCCTTAGG + Intergenic
1158470156 18:57728995-57729017 CAGGCATGAGTCGCCGCACCCGG + Intronic
1158481008 18:57821805-57821827 CAGCCATGAGCCCCCGCATCTGG - Intergenic
1160686623 19:439685-439707 CAGGCAGGAGCCGCTGCATCTGG - Intronic
1160796858 19:949585-949607 TAGGCAGGAGCCGCCGCCCCTGG + Intronic
1160807756 19:1000212-1000234 CCGCCAGGTGTCACCGCCGCCGG + Intergenic
1161337311 19:3721602-3721624 CGGCCTGGAGTTTCCGCCTCAGG + Intronic
1161541655 19:4855400-4855422 CAACCAGGAGCCCCCGTCTCAGG - Intronic
1163588075 19:18174594-18174616 CAGGCATGAGCCACCGCCTCCGG - Intronic
1163607608 19:18283621-18283643 CAGGCAGGAGTCACCGCGTGTGG - Intergenic
1164650008 19:29884740-29884762 CAGCCAGGAGTAGCTGTGTCAGG + Intergenic
1165073634 19:33269231-33269253 CAGGCAGGGGTCACCGGCTCAGG - Intergenic
1165691098 19:37863894-37863916 CAGGCATGAGTCACCGCGTCTGG + Intergenic
1165981441 19:39727678-39727700 CAGCCATGAGCCACAGCCTCTGG + Intergenic
1166949507 19:46417086-46417108 CAGGCATGAGTCACCGCCCCCGG - Intergenic
1167146286 19:47682122-47682144 CAGCCAGGCTTCCCCGGCTCCGG + Exonic
1168012401 19:53543949-53543971 CAGCCATGAGCCACCGCGTCTGG - Intronic
1168045691 19:53792719-53792741 CAGGCATGAGTCACCGCATCTGG + Intergenic
1168362051 19:55749594-55749616 CAGGCATGAGTCGCCACCCCCGG + Intergenic
1202658887 1_KI270708v1_random:50052-50074 CAGGCATGAGCCGCTGCCTCTGG + Intergenic
926130722 2:10302186-10302208 GAGCCAGGAGGCGCCGACCCTGG + Intergenic
929599814 2:43198092-43198114 CAGGCGGGAGTCACCGCGTCCGG + Intergenic
929660383 2:43778429-43778451 CAGGCATGAGTCACCGCCCCTGG + Intronic
930284059 2:49405874-49405896 CAGGCAGGAGACACCGCCCCTGG + Intergenic
931982562 2:67710061-67710083 CAGCCATGTGTCACCTCCTCAGG - Intergenic
933713594 2:85344771-85344793 GAGCAAGGAGTGGCCGTCTCCGG - Intronic
935216716 2:100980746-100980768 CAGGCATGAGTCACCGCCCCAGG + Intronic
938062785 2:128265947-128265969 CTGCCAGCTGCCGCCGCCTCTGG + Exonic
938370418 2:130764608-130764630 CAGCCAGAAGTGGGGGCCTCTGG + Exonic
939814735 2:146880080-146880102 CAGGCATGAGTCACCGCGTCTGG + Intergenic
942563997 2:177248684-177248706 CAGGCATGAGCCACCGCCTCTGG + Intronic
946662442 2:222015818-222015840 CAGGCATGAGCCACCGCCTCTGG + Intergenic
947046611 2:225994369-225994391 CAGGCATGAGCCGCCGCATCTGG - Intergenic
947444443 2:230153062-230153084 CAGGCATGAGTCGCCGCACCTGG + Intergenic
947530958 2:230908364-230908386 CGGACAGGAGTCGCCTTCTCAGG - Exonic
948734783 2:239994995-239995017 CAGACATGAGTCGCCGCACCCGG - Intronic
949020737 2:241739865-241739887 CAGGCATGAGTCGCCGCGCCCGG - Intronic
1170968375 20:21096545-21096567 CAGACAGGAGTCTCCGACCCTGG + Intergenic
1171348313 20:24483588-24483610 CACCCAGGAGTCCCAGCCTGAGG + Intronic
1172447844 20:35002500-35002522 CAGGCAGGAGCGGCTGCCTCAGG + Exonic
1174010203 20:47443507-47443529 CAGGCATGAGTCACCACCTCTGG - Intergenic
1174317966 20:49717338-49717360 CAGGCATGAGCCACCGCCTCCGG + Intergenic
1174377904 20:50138670-50138692 CAGCCTGGAGTCACTGCCACCGG - Intronic
1175924661 20:62465906-62465928 CTGCCAGGTGCCGCGGCCTCTGG - Exonic
1176046194 20:63094074-63094096 CAGCCAGGAGACAGCGGCTCTGG - Intergenic
1176288398 21:5031457-5031479 CAGGCATGAGTCACCGCGTCCGG - Intronic
1178324199 21:31630291-31630313 CAGGCATGAGTCACCGCATCTGG - Intergenic
1178852456 21:36224455-36224477 CAGGCATGAGCCGCCGCATCTGG + Intronic
1179054155 21:37916148-37916170 CAGCCAGGTGCGGCCGTCTCCGG + Exonic
1179529829 21:42010745-42010767 CCGCCAGTAGTCCCCGCTTCCGG + Intergenic
1179868784 21:44232018-44232040 CAGGCATGAGTCACCGCGTCCGG + Intronic
1179899632 21:44382732-44382754 CAGTCAGCAGCTGCCGCCTCCGG - Exonic
1180094636 21:45550238-45550260 CAGGCAGGAGGCGCCTCCCCAGG - Intergenic
1180622627 22:17171953-17171975 CCTCCAGGGGGCGCCGCCTCCGG - Intergenic
1181332352 22:22103181-22103203 CAGGCAGGAGTCTGCGCCTGTGG + Intergenic
1181745364 22:24952391-24952413 CAGCCAGGATCCCCCGCCACCGG - Intergenic
1182127632 22:27827721-27827743 CAGCCAGGAGACGGGGCCCCTGG + Intergenic
1183474803 22:38030266-38030288 GAGCCAGGAGTCGGGCCCTCTGG + Intronic
1183939644 22:41286069-41286091 CAGGCCGGGGTCGCCACCTCCGG + Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184279613 22:43429531-43429553 CACCCAGGTGTCACCACCTCAGG + Intronic
1185040322 22:48500759-48500781 CAGCCTGCCGTCGCCGCCTCGGG + Intronic
1185110481 22:48897677-48897699 CAGACAGAAGACGCCGCCCCGGG + Intergenic
1185288461 22:50012712-50012734 CAGCCTGGAGCCGCTGCCACAGG - Intergenic
1185349163 22:50325610-50325632 CAGGCATGAGTCACCGCGTCCGG + Intronic
949420152 3:3856846-3856868 CAGGCAGGAGGCACCGCATCTGG + Intronic
949742541 3:7252965-7252987 CAGACAGGAGCCACTGCCTCTGG + Intronic
952215794 3:31277227-31277249 CAGCCAGGAGTTTCTTCCTCTGG - Intergenic
953416665 3:42724432-42724454 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
954403396 3:50331393-50331415 CTGCCAGGAGCCGCAGCCGCAGG + Exonic
954584657 3:51722620-51722642 CAGCCAGGAGCCACCACGTCTGG + Intergenic
956028702 3:65012311-65012333 CAGGCAGGAGCCACCGCATCCGG - Intergenic
956659217 3:71582654-71582676 CTGCGAGGAGTCGCCGCGCCCGG - Intronic
961190630 3:124958212-124958234 CAGCCATGAGCCACCGCATCCGG - Intergenic
961365244 3:126395321-126395343 CAGTCAGGAGGGGCTGCCTCTGG - Intronic
963193888 3:142504739-142504761 CAGGCATGAGCCGCCGCATCCGG + Intronic
965789124 3:172368731-172368753 CAGGCATGAGTCACCGCATCTGG - Intronic
968486502 4:865588-865610 CAGCCAGGTGGAGCCACCTCGGG - Intronic
968831592 4:2935011-2935033 AGGCCAGGAGTCTCGGCCTCGGG - Intergenic
973813626 4:54597899-54597921 CAGGCATGAGTCACCGCCCCCGG - Intergenic
975118676 4:70705520-70705542 CAGGCAGGAGCCGCGGCCTGGGG - Intronic
975870794 4:78776448-78776470 CCGCGAGGGGTCGCCGCCCCTGG - Exonic
979683225 4:123483897-123483919 CAGGCATGAGCCGCCGCCCCCGG + Intergenic
980069690 4:128230402-128230424 CAGGCATGAGCCACCGCCTCCGG - Intergenic
981609312 4:146576308-146576330 CAGGCATGAGTCACCGCCCCTGG + Intergenic
983052416 4:163064008-163064030 CAGGCATGAGTCACCGCCCCTGG - Intergenic
984358569 4:178697627-178697649 CAGCCATGAGCCACCGCCCCTGG - Intergenic
987402463 5:17492028-17492050 CAGCCAGGAGTCTCCCTCGCAGG + Intergenic
989443675 5:41503509-41503531 CAGCCAGGATTAGTCACCTCCGG - Intronic
991587358 5:68215094-68215116 CAGCCTGGCACCGCCGCCTCCGG - Intergenic
991999365 5:72420262-72420284 CAGGCAGGAGCCACCGCGTCCGG - Intergenic
993968822 5:94391469-94391491 CTGCCAGCAGACGCTGCCTCAGG + Intronic
998371148 5:141662190-141662212 CAGCCAGGAGTCTCAGGCTGCGG + Exonic
999998165 5:157112248-157112270 CAGGCAGGAGCCGCCGCACCTGG + Intronic
1002318768 5:178362650-178362672 CACCCAGGAGTCTCCGCCATGGG + Intronic
1002646104 5:180656302-180656324 CAGACATGAGCCACCGCCTCTGG - Intergenic
1003462254 6:6340457-6340479 CAGGCATGAGCCGCCGCGTCCGG + Intergenic
1006857521 6:37145620-37145642 CAGGCATGAGTCACCGCATCCGG + Intergenic
1007999249 6:46341519-46341541 CAGGCAGGAGCCACCGCCCCCGG - Intronic
1009782153 6:68284789-68284811 CAGTCAGGAGTCTCAGCCGCAGG - Intergenic
1012278677 6:97303045-97303067 CAGCCATGAGCCACCGCATCTGG + Intergenic
1016359838 6:143255379-143255401 CAGCCAAGAATCGAGGCCTCAGG - Intronic
1019542882 7:1559476-1559498 CGCCCAGGAGCCGCCTCCTCAGG + Intronic
1020022641 7:4878264-4878286 CGGGCAGGAGTCACCGCCTGTGG - Intronic
1020098851 7:5383178-5383200 CAGGCATGAGCCGCCGCATCTGG + Intronic
1020139900 7:5606451-5606473 AAGCCAGGCGTCGCCCCCTCCGG + Exonic
1023544272 7:41300986-41301008 CAGCCATGAGCCACCGCCCCTGG + Intergenic
1024639450 7:51317110-51317132 CCGCCAGGAGGCGCCGGCCCCGG - Intergenic
1026809759 7:73453705-73453727 CAGGCAGGAGCCACCGCATCTGG - Intronic
1027438359 7:78191591-78191613 GAGCCTGGAGTTGCCACCTCTGG + Intronic
1028332876 7:89618547-89618569 CACCCTGAAGTCGCAGCCTCAGG + Intergenic
1030261755 7:107572570-107572592 CAGGCATGAGCCACCGCCTCTGG - Intronic
1030903841 7:115158159-115158181 CACCCAGGTGAAGCCGCCTCAGG + Intergenic
1032013555 7:128361612-128361634 GAGCCAGGAGGCGGCGCCGCTGG - Exonic
1032239985 7:130153196-130153218 CAGCCAGGGGTGGCAGCCACTGG + Intergenic
1034453321 7:151149540-151149562 GAGCCAGGCCTCGCAGCCTCAGG + Intronic
1034634413 7:152555838-152555860 CAGGCGGGAGCCACCGCCTCCGG + Intergenic
1036644305 8:10602263-10602285 CAGCCAGGACTGGCCTCCTGGGG - Intergenic
1036919843 8:12841630-12841652 CAGGCATGAGCCACCGCCTCTGG - Intergenic
1038798186 8:30727676-30727698 CAGGCAGGAGCCGCAGCCGCAGG - Exonic
1039489519 8:37937093-37937115 CACCCAGGAGTGGCGGCCCCAGG + Intronic
1039503682 8:38035982-38036004 CAGCCATGAGTCACCGCGCCCGG + Intronic
1039590380 8:38741434-38741456 CAGGCAGGAGCCGCCGCGCCTGG + Intronic
1040005546 8:42617810-42617832 CACCCAGGAGTCGCCATCTACGG + Intergenic
1042141339 8:65681395-65681417 CAGGCAGGAGCCGCCGCACCTGG + Intronic
1043471824 8:80570653-80570675 CAGGCATGAGTCACCGCCCCCGG + Intergenic
1045679045 8:104639423-104639445 CAGCCAGGAGTCTCTACCACAGG + Intronic
1046765523 8:118065128-118065150 CAGGCATGAGTCACCGCCCCTGG + Intronic
1049316456 8:141971424-141971446 CAGACAGGAGGAGCCACCTCGGG - Intergenic
1051896053 9:21990098-21990120 CAGGCAGGTCTCGCCGCCTCCGG - Intronic
1054147735 9:61575235-61575257 CAGCCACAAGTCCCAGCCTCTGG - Intergenic
1054652640 9:67636759-67636781 CAGCCACAAGTCCCAGCCTCTGG - Intergenic
1056137920 9:83647484-83647506 CAGCCAGGGGTGGGAGCCTCAGG + Intergenic
1056490587 9:87103072-87103094 CAGCCATGAGCCGCCGCACCTGG - Intergenic
1060109784 9:120898392-120898414 CAGGCATGAGCCACCGCCTCCGG + Intergenic
1060479733 9:124011237-124011259 CGGCCTGGAGCCGCGGCCTCAGG - Intronic
1061475915 9:130866208-130866230 CAGCCAGGAGTGGCAGCATCAGG + Intronic
1062141735 9:134962884-134962906 CAGCCATGAGTCACCGCGCCCGG + Intergenic
1062346113 9:136116066-136116088 CAGCCAGGAGGGCCCCCCTCCGG + Exonic
1062569613 9:137179103-137179125 CAGGCAGGAGGAGCAGCCTCAGG - Intronic
1186703617 X:12118425-12118447 CAGCCAGCAGTCGCCTGCTGCGG - Intergenic
1194633486 X:96315537-96315559 CAGGCATGAGCCACCGCCTCTGG + Intergenic
1196432246 X:115638989-115639011 CAGGCATGAGTCACCGCCCCCGG + Intronic
1198183736 X:134234919-134234941 CAGCCATGAGTCACCGCACCTGG - Intergenic
1199862690 X:151816111-151816133 CAGTCAGGAATCCACGCCTCTGG + Intergenic