ID: 1130423020

View in Genome Browser
Species Human (GRCh38)
Location 15:83767158-83767180
Sequence GTTCACCTGCAAAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 366}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130423015_1130423020 10 Left 1130423015 15:83767125-83767147 CCTTGGACACACATGGTTCTCAA 0: 1
1: 0
2: 1
3: 23
4: 189
Right 1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG 0: 1
1: 0
2: 6
3: 55
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130423020 Original CRISPR GTTCACCTGCAAAATGGGGA TGG Intronic
900731312 1:4262736-4262758 GTGCACCTGCAAGCTGGGGTAGG - Intergenic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901272599 1:7964284-7964306 CTTCAACTGTAAAATGAGGATGG - Intronic
901300706 1:8198227-8198249 GTGCAGCTGTAAAATGAGGATGG + Intergenic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902726299 1:18338459-18338481 ATTGACCTCCAAACTGGGGAGGG - Intronic
902759659 1:18572885-18572907 GTTTCTCTGCAGAATGGGGAGGG - Intergenic
903073421 1:20741653-20741675 CTTAACCTACAAAATGAGGAAGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903591408 1:24458649-24458671 GTTCAATTGGGAAATGGGGATGG + Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904416221 1:30362598-30362620 TTTCTTCTGTAAAATGGGGATGG - Intergenic
904556359 1:31367442-31367464 GTTCACCTGCAGAAATGGGACGG - Exonic
904748419 1:32725507-32725529 CTTGGCCTGCAAGATGGGGATGG + Intergenic
904918366 1:33986432-33986454 CTTCAGCTGTAAAATGGGCATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905390514 1:37633315-37633337 GTGGACCTGCAAAGTGGGGACGG + Intronic
905458683 1:38106559-38106581 AGTCACCTGTAAACTGGGGATGG + Intergenic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906087140 1:43145486-43145508 TGTCTCCTGCAAAAAGGGGAGGG + Intronic
906394412 1:45448926-45448948 GTTGAAATGCAAAATGGGGCAGG + Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
910226753 1:84943739-84943761 TCCCACCTACAAAATGGGGAGGG + Intronic
910669821 1:89761972-89761994 GGTCAGATGCAAAATGGTGAAGG - Intronic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
911587977 1:99713189-99713211 ACTCACCTGTAAAATGGGGGTGG - Intronic
911635929 1:100236353-100236375 GTTAACCTGGAAAAGTGGGAGGG - Intronic
912563790 1:110570384-110570406 TTTGATCTGGAAAATGGGGATGG + Intergenic
912627353 1:111216535-111216557 TTTTCCCTGTAAAATGGGGAAGG + Intronic
913577181 1:120188088-120188110 ATTCACATGCAAAATGATGATGG + Intergenic
914559094 1:148799523-148799545 ATTCACATGCAAAATGATGATGG + Intergenic
914613739 1:149330706-149330728 ATTCACATGCAAAATGATGATGG - Intergenic
915463924 1:156084948-156084970 GTCCAGCTGCTGAATGGGGAAGG + Intronic
915555420 1:156658249-156658271 CTACACCTGCAAGATGGGGCTGG + Exonic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
919619197 1:199846157-199846179 GTTCACTGGAAAAATGGTGATGG - Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
921476033 1:215610772-215610794 TTTCATCTGTAAAATGGAGATGG + Intronic
921630705 1:217430174-217430196 GTTCACCTTCTAAATGGGTTGGG + Exonic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
922053166 1:222014440-222014462 CTTTACCTGTAAAATGGAGAGGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
1062995127 10:1858465-1858487 TCTCACCTGCAAAATGAGTAGGG - Intergenic
1063948819 10:11203758-11203780 GATGACCCCCAAAATGGGGATGG - Intronic
1064387411 10:14909036-14909058 CTTCACCTGCAAAAGGCTGATGG - Exonic
1065319474 10:24495731-24495753 GCCCAGCTGCAATATGGGGATGG + Intronic
1067526340 10:47040961-47040983 GTTCACCTGGAATGTGGGGCAGG + Intergenic
1069542588 10:69306530-69306552 GTTCACATGTGAAATGAGGAGGG + Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071499054 10:86190573-86190595 GCACACCTGCAGGATGGGGATGG - Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072656180 10:97332141-97332163 GTTTTTGTGCAAAATGGGGAGGG - Intergenic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1072916150 10:99538423-99538445 GTTCACCAGAAAAATGGGGGTGG - Intergenic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1075426458 10:122345497-122345519 GTGCACCTGCAAAAGGGGTGAGG + Intergenic
1076436707 10:130451271-130451293 GTTCACCTGGAAAATGGGATGGG + Intergenic
1077156407 11:1093938-1093960 TTTCAGTTGCAAAATGAGGATGG + Intergenic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079311588 11:19371386-19371408 GTTAACCTGTAAAATGAGGGAGG - Intronic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083200785 11:61119816-61119838 GCTCAGCTGCCACATGGGGAAGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083275884 11:61596876-61596898 CTCCACCTGTAAAATGGAGATGG - Intergenic
1085130255 11:74032168-74032190 CTTCACCTGTAAAATGGAGGCGG - Intronic
1085196717 11:74677087-74677109 CTTCAGCTGGAAAATGGGGGTGG - Intergenic
1085620253 11:78032502-78032524 CATCACCTGGAAAATGGGGGTGG - Intronic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1087500354 11:98944213-98944235 GTTCAGCTGGGAGATGGGGACGG - Intergenic
1087706102 11:101493626-101493648 TTTCATGTGCAAAATGGGAACGG - Intronic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1087833319 11:102843772-102843794 GTTGCCTTGCAAAATTGGGAAGG - Exonic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089640968 11:119846997-119847019 GTGAACCTGGAAAAGGGGGAAGG + Intergenic
1090358320 11:126155565-126155587 TTCCATCTGTAAAATGGGGATGG - Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091444509 12:535850-535872 GTGGACCTGCACAATAGGGAGGG + Intronic
1092035353 12:5329724-5329746 ATTCACCTGAAAAATGAGGAGGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094107607 12:26831113-26831135 GTCCACCTGCAAAATGTTGCTGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1097173409 12:57129415-57129437 GTTCGGCTGCAAAAGGGGGTGGG + Intronic
1097390783 12:59010289-59010311 GTTGACCTGCAACAGTGGGAGGG - Intergenic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1100025328 12:90121586-90121608 GTTCTCCTGCATAATGTGTATGG + Intergenic
1100883167 12:99040627-99040649 CTTAACCTGTAAAATGGGAATGG + Intronic
1101173211 12:102120787-102120809 CTTCACCTGCAAAACCAGGAAGG - Intronic
1101750207 12:107577269-107577291 CTTCACCTGTAAAGTGGGGTGGG - Intronic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102199294 12:111046415-111046437 GTTCATCTGTAAAATGGGAATGG - Intronic
1102274564 12:111571072-111571094 CTTCCCCTGTAAAAAGGGGATGG - Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1103067144 12:117908954-117908976 ATTCACCTGCAAAATTGGATTGG - Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105733829 13:23247138-23247160 GTTCTCCTGCAAGATGGCCAAGG - Intronic
1105887382 13:24653461-24653483 GGTCTCCTGCAGAATGTGGAAGG - Intergenic
1106025671 13:25953318-25953340 TTTCTTCTGTAAAATGGGGACGG + Intronic
1106235996 13:27860968-27860990 TTTGACTTGCAAAGTGGGGAGGG - Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107616233 13:42171210-42171232 TTTCACCAGTAAAATGGAGATGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1108095146 13:46893645-46893667 GGTCACCTGCTATATGAGGAAGG + Intronic
1108967330 13:56326109-56326131 GTACATCTGTAAAATGGGGGTGG + Intergenic
1110888198 13:80665515-80665537 GTTCAACAACAAAATGGAGAGGG - Intergenic
1111192617 13:84830456-84830478 TTTCACCTGAAGAATGGTGAGGG + Intergenic
1111699073 13:91662989-91663011 GCTAGCCTGCAAGATGGGGAAGG + Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113673666 13:112194031-112194053 GTTTATCTACAAAATGAGGAAGG - Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1114416295 14:22546849-22546871 TTTCACCTGCAAAATGAATATGG - Intergenic
1115542075 14:34430328-34430350 GTTCACCTGTTAAATAGGGATGG - Intronic
1117572241 14:57058908-57058930 TTTCATCTGTAAAATGGGCATGG - Intergenic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118398818 14:65360921-65360943 ATTGTTCTGCAAAATGGGGATGG + Intergenic
1118436891 14:65779726-65779748 GTTCTCCTACAAGGTGGGGAAGG - Intergenic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120115985 14:80617973-80617995 TTTCATCTATAAAATGGGGATGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121415846 14:93778977-93778999 GTGCTCCTGCAAGATGGAGAAGG - Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122118242 14:99538160-99538182 CTGCACCTGGAAAATGAGGATGG - Intronic
1122531028 14:102427079-102427101 GTTTTCCTGTAAAATGGGGTGGG + Intronic
1123682744 15:22774329-22774351 TCACACCTGTAAAATGGGGATGG - Intronic
1124689135 15:31807185-31807207 TTTCACCTGCAAAATGGGAACGG - Intronic
1127367181 15:58302080-58302102 ATTCACCTGAAAAAGAGGGAGGG + Intronic
1127631935 15:60835627-60835649 CTTCACCTGTAAAATAGAGATGG - Intronic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128735696 15:70052672-70052694 TCTCACCTATAAAATGGGGATGG - Intronic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1129150858 15:73686996-73687018 GTCCACCAGCAAAAGGGGGAGGG + Intronic
1129692878 15:77723754-77723776 CTTCACCTGTGACATGGGGATGG + Intronic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130867145 15:87942736-87942758 TCTCACCTGTAAAATGGGTATGG + Intronic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1133850707 16:9500676-9500698 TCTCACCTGTAAAATGGAGAGGG + Intergenic
1134010338 16:10847362-10847384 GTAATCCTGCAATATGGGGAAGG - Intergenic
1134233032 16:12443842-12443864 CTTCACTTGCAAAAAGGGTATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134693450 16:16206027-16206049 TTCCATCTGCAAAATGGGGTCGG + Intronic
1137569900 16:49558509-49558531 TTTCTCCTGCACACTGGGGAGGG - Intronic
1137823072 16:51464062-51464084 TTTCACTTGTAAAATGGGGAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141313754 16:82940307-82940329 TTCCACCTGTAAAATGGAGACGG + Intronic
1141638747 16:85329237-85329259 GTTCATCTGTAAAATGGGGGTGG + Intergenic
1142886603 17:2916621-2916643 CTTCACTTGCATAATAGGGACGG + Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1146921024 17:36711756-36711778 TTTCACCTGTGAAATGGGGATGG + Intergenic
1148336802 17:46847540-46847562 GGTCACCTGGAGGATGGGGAAGG + Intronic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1150193439 17:63268213-63268235 GTTCACCTGCAATATGGCTAGGG - Intronic
1150322541 17:64227782-64227804 TTTCATCTGTAAAATGGGAATGG + Intronic
1150630080 17:66874164-66874186 GCTCACCTGTAAAATGGGTGTGG + Intronic
1151477848 17:74353976-74353998 TTTCATCTGCAAATGGGGGATGG - Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG + Intergenic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1158616965 18:58996898-58996920 GTTCACCTACACAATGGGCCAGG - Intergenic
1159100767 18:63955836-63955858 GGACCCCTACAAAATGGGGAAGG + Intronic
1159485990 18:69057793-69057815 GTTTATCTGCAAGATGGGCATGG - Intergenic
1160075734 18:75674834-75674856 GTTTATCTGCAACATGGGGCAGG + Intergenic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161655236 19:5510369-5510391 GTGCACCTGGAAAAGGGGGAGGG + Intergenic
1162056014 19:8064541-8064563 TTTTCCCTGTAAAATGGGGATGG + Intronic
1163172836 19:15544407-15544429 CTTCAGCTACAAAATGGGGGTGG + Intronic
1163740464 19:19008725-19008747 GTTCACCTGGCAATTGGGGTTGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166389354 19:42400452-42400474 GGTCAGGTGCAAAGTGGGGAGGG - Intergenic
1167087632 19:47321003-47321025 GTTCACCTTGCAAATGAGGAAGG - Exonic
1168345162 19:55647098-55647120 GTTAATCTGTAAAGTGGGGAGGG + Intronic
925355346 2:3237111-3237133 GTCCACCTGGGAGATGGGGAGGG + Intronic
925492381 2:4409634-4409656 GTTTACCTGGACATTGGGGATGG + Intergenic
925614909 2:5735589-5735611 GTTCACCTACAAACTGGTGTTGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926389836 2:12378148-12378170 TTTCATCTGCAAAATAGAGATGG + Intergenic
926621815 2:15053431-15053453 GTTCACCCACAAAATGAGGGAGG + Intergenic
926651729 2:15353705-15353727 GATAACCTGCAAAATTGGCAAGG + Exonic
926654375 2:15384527-15384549 GTTTACCAGAAAAATGGGGGGGG - Intronic
926861685 2:17316831-17316853 CTTCACCTGATAAATGGGGTAGG + Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927904980 2:26849207-26849229 GTTCTGCTGAAGAATGGGGAGGG + Intronic
928913193 2:36443488-36443510 GTTGACCTGCAAAAGATGGAAGG - Intronic
929323036 2:40568961-40568983 TTCCACCTGTAAAATGAGGATGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
933859439 2:86450139-86450161 GTTCACTTGACAAATAGGGATGG + Intronic
934504569 2:94880375-94880397 GTGCTCCCACAAAATGGGGAGGG - Intergenic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
936583728 2:113731893-113731915 TTTCACATGTAAAATGGGAATGG - Intronic
937228675 2:120384336-120384358 TTTCATGTGCAAAATGGGGCTGG + Intergenic
937678622 2:124619612-124619634 ATTGACCTCCATAATGGGGATGG + Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
940636137 2:156299407-156299429 GTTGACCTCCAGAATTGGGAAGG - Intergenic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
944020737 2:195100590-195100612 ATTCATCTGTAAAATGGAGAAGG + Intergenic
945884066 2:215355927-215355949 ATTCTTCTGTAAAATGGGGATGG + Intergenic
946737119 2:222764915-222764937 GTGCACCTGGAAAAAGGGGAGGG + Intergenic
946792712 2:223317642-223317664 GCTCACCTGAAAAATGGCTAGGG - Intergenic
947297788 2:228651891-228651913 GTTCTCCTTCAAATTTGGGAAGG - Intergenic
947389189 2:229622229-229622251 GTACACCTGGAAAATAGTGATGG + Intronic
948546096 2:238729969-238729991 GCTCTCCTGAAAAATGGGCAGGG - Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1170601371 20:17843858-17843880 GTTCACAAGCAAAATGAGGGAGG + Intergenic
1172186467 20:33034176-33034198 CTTCACCTTCAAACTGGGAAGGG - Exonic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1173785983 20:45792932-45792954 ACTCACGTACAAAATGGGGAAGG + Intronic
1173795130 20:45854596-45854618 CTTCAGCTGTAAAATGGAGAAGG - Intronic
1173818788 20:46007721-46007743 CTTCAACTGCAAATTGGGGCAGG - Intergenic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174429847 20:50459884-50459906 TTTCTCCTGCAAAATTGGGCCGG + Intergenic
1174520779 20:51128948-51128970 GTTCCCCTGAGAAAGGGGGAGGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175619434 20:60431001-60431023 GTACACCTGCAAAAAGGACATGG - Intergenic
1175664183 20:60844125-60844147 GTTCACCTTGAAAACGGAGACGG + Intergenic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182287574 22:29257419-29257441 CTTCACCTGTAAAATGGCCACGG - Intronic
1182623130 22:31628702-31628724 GTACATCTGGAAAATGGGAAAGG + Intronic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1183035577 22:35138666-35138688 GCTCACCTGTGAAATGGGGGTGG + Intergenic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183527018 22:38329133-38329155 TTCTACCTGCAAAATGGGCAGGG - Intronic
1183730553 22:39616226-39616248 GTTCCCCTCCAAGATGGGGGCGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184658587 22:45954876-45954898 GCACACCTGCAAAATGAGGATGG - Intronic
1185042944 22:48514920-48514942 TTTCACCCCCAAAATGGAGATGG - Intronic
949238495 3:1840718-1840740 AGTCTCCTGCAAAATGGAGATGG + Intergenic
949441636 3:4087377-4087399 CTCCACCTGCAAGATGGGAATGG - Intronic
949496870 3:4640697-4640719 GCTCACCAGCAAAATGGAAATGG + Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950648636 3:14393437-14393459 GTCCATCTGTAAAATGAGGATGG - Intergenic
951736582 3:25872618-25872640 GTTAAGCAACAAAATGGGGAAGG + Intronic
953904584 3:46862064-46862086 CTTTACCTGCAACCTGGGGATGG + Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
955708531 3:61754264-61754286 GCTCAGCTGTAAAATGGAGATGG + Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957360001 3:79142769-79142791 ATTTTCCTGCAAAATGGGAAAGG + Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958567389 3:95831572-95831594 GTTTCCCTGCAAATTGTGGAAGG - Intergenic
961370213 3:126424167-126424189 GTTCAGCAGCATAACGGGGACGG + Intronic
961404071 3:126666636-126666658 GTTCATCTGCAACATGGAGATGG - Intergenic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963261800 3:143200074-143200096 TTTCACCTGTAATATGAGGAAGG + Intergenic
964116082 3:153137689-153137711 CTTCACATGGCAAATGGGGAAGG - Intergenic
964355120 3:155843701-155843723 GTTCACCTGTAAATTTGGGCTGG - Intronic
965073985 3:163953490-163953512 GCTCTCAGGCAAAATGGGGAGGG - Intergenic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
967534889 3:190590644-190590666 TTTCACTTGTAAAATGGGAAGGG + Intronic
967754028 3:193148244-193148266 ATTCAACTGCACACTGGGGATGG + Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
971451425 4:26805123-26805145 GTTCAGCTGCAACATGGGTGGGG + Intergenic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973099781 4:46251556-46251578 GTTCATGTGAAAAATGGGGTGGG - Intronic
973177962 4:47231366-47231388 TTTCATCTGTAAAATGAGGAGGG + Intronic
973991200 4:56409170-56409192 GTTTATCTGTAAAATGGGCATGG - Intronic
976146016 4:82043774-82043796 GTTCACCTGTCAACTGGGAAGGG + Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977805219 4:101289512-101289534 GTTTCACTGCAAAATGAGGAAGG - Intronic
978309208 4:107367443-107367465 GTTCACCTGCCAACTTTGGAGGG + Intergenic
979382904 4:120029609-120029631 TTTCACCTGCAACATGGAGAAGG + Intergenic
980074019 4:128274909-128274931 TTTTATCTGCCAAATGGGGAAGG - Intronic
981190502 4:141856858-141856880 GATCACCTGTGAAATGTGGATGG - Intergenic
986243748 5:5985590-5985612 GTCCAGCACCAAAATGGGGAAGG - Intergenic
986542822 5:8865075-8865097 GTTCACCTAGTAATTGGGGAAGG - Intergenic
987037956 5:14036851-14036873 TTTTACCAGGAAAATGGGGAGGG - Intergenic
987048303 5:14127662-14127684 GTGCACCTGCAGCATGGGGAAGG + Intergenic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989508953 5:42260929-42260951 GGTCTCCAGCAAAATGAGGAAGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
990544312 5:56807215-56807237 CTTCACCTGGAAAATGGCGATGG + Intergenic
990799726 5:59587019-59587041 GTTCAACTGCAAAAGTAGGAAGG + Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
993820423 5:92608161-92608183 TTTAATCTGTAAAATGGGGATGG + Intergenic
994848483 5:105021661-105021683 GTTGACCTGCAAAATTGGAGTGG - Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995420452 5:111961087-111961109 CTTCACTTGCAAAGTGGGAAGGG - Intronic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997700796 5:135897707-135897729 GTTCCACTGCACTATGGGGAAGG + Intergenic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1001284623 5:170413534-170413556 CTTCATCTGCAAGATGGGAATGG + Intronic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1002763552 6:219705-219727 CTCCACCTGCAAAATGAGGTGGG - Intergenic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1004064788 6:12233409-12233431 GTTTACCTGTAAAATGGTGGAGG - Intergenic
1004110404 6:12712744-12712766 GTTCATCTGGAAATAGGGGAAGG - Intergenic
1007225802 6:40313283-40313305 ATGCCCCTGCAAAATGGTGAGGG - Intergenic
1007833944 6:44659952-44659974 CATCACCTGCAAAATGGGTTAGG + Intergenic
1007872034 6:45051237-45051259 GTTAAGCTACAATATGGGGAGGG + Intronic
1007910039 6:45504374-45504396 TTTCACCTGTAACATGGGAATGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1009342493 6:62573300-62573322 GTGCAACTGAAAAATGGGAATGG - Intergenic
1010450500 6:75996867-75996889 GTTCACCTCCAGAATGAAGAGGG + Intronic
1015156280 6:130100228-130100250 TTTCATCTGTAAAATGAGGATGG - Intronic
1015469894 6:133592462-133592484 GTTTACCTGTAATATGAGGAAGG - Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1018985067 6:168629994-168630016 GTTCCCCTGAAGAATGGGGCAGG - Intronic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021217919 7:17940239-17940261 GTTTACCTGTGAAATGGGGAAGG - Intronic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1021982760 7:26070753-26070775 GTTCACCTCCGAGCTGGGGAAGG - Intergenic
1022403487 7:30064158-30064180 GTTCATCTATAAAATGGGAATGG + Intronic
1022413394 7:30156960-30156982 GTTCAACAGCAAAATGGTTATGG - Intronic
1023183134 7:37506175-37506197 TCTCACCTGTAAAATGAGGATGG - Intergenic
1023212393 7:37821391-37821413 GTTCTCCTGCAGAATGGTGAGGG - Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024985650 7:55191363-55191385 GTTTATCTGCAAAGTGGGGGTGG - Intronic
1026461154 7:70616291-70616313 CTTCACCTGCCACATGGGGCTGG - Intronic
1026827475 7:73593583-73593605 TTCAATCTGCAAAATGGGGATGG - Exonic
1029151994 7:98487164-98487186 GTGCATGTGCAAAATTGGGAGGG + Intergenic
1030065180 7:105653867-105653889 GTTCACCTGGAGAATGGGGGAGG - Intronic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1032873928 7:136017040-136017062 GTTCACCTGGAACATGGGAAAGG - Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1036125073 8:6055094-6055116 GTTCATATTAAAAATGGGGAAGG + Intergenic
1036408859 8:8479749-8479771 CTTCCCCTGTAAAATGAGGATGG - Intergenic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1038003843 8:23413223-23413245 TCTCACCTGTAAAATAGGGAGGG + Intronic
1041984622 8:63907559-63907581 TCTTACCTGCAAAATGGGTATGG - Intergenic
1044299320 8:90565420-90565442 GTTTACTTGCAACATGTGGAAGG - Intergenic
1044570404 8:93711640-93711662 CTTAACCTGAAAAATGGGAATGG + Intronic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1047448507 8:124941446-124941468 CTTCACCTGTAAAATGAGGATGG - Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047619208 8:126589091-126589113 GTTCCCTTGCCAAATGGAGAGGG + Intergenic
1047697077 8:127414738-127414760 GTCCTCCTGCCAAATGGTGAAGG + Exonic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1050150442 9:2614506-2614528 TTTCATCTGAAAAATGGGGGTGG - Intergenic
1051599161 9:18854940-18854962 CTTACCCTGGAAAATGGGGAGGG - Intronic
1054949649 9:70835590-70835612 GATCACCTGCCACATGGAGAAGG - Intronic
1055073805 9:72193877-72193899 CTCCACCTTCAAAAAGGGGAAGG - Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056101186 9:83301979-83302001 GTTCACCTGGACATTTGGGAGGG - Intronic
1056482682 9:87021621-87021643 GTGCACCCGCAAAATTCGGAAGG - Intergenic
1057504085 9:95618332-95618354 TGTCACCTGGAAAATGTGGAGGG - Intergenic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058930123 9:109710547-109710569 TTTCACCTGCAAGACGGGGTGGG + Intronic
1059330978 9:113535674-113535696 GTCCAACTGCAAAATGAGAAAGG + Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1185857799 X:3552040-3552062 GTTCATCTGTAGAATGTGGATGG - Intergenic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1188960988 X:36491159-36491181 CTTCACCTGCTACATGGGGAAGG - Intergenic
1190090054 X:47429676-47429698 GCTCACCATCAAAATGAGGAGGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1193764168 X:85505563-85505585 TTTCACCTGCAAATTGGGCATGG - Intergenic
1195937949 X:110143137-110143159 GGTCACCTGGAAAATAGGGAAGG - Intronic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1197893374 X:131287240-131287262 GTTCATCAGTAAAATGGGGATGG - Intronic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1200211871 X:154350293-154350315 ATGGACCGGCAAAATGGGGAGGG - Intronic
1200308238 X:155050753-155050775 GTTCACTTTAAAAATGGGTAAGG - Intronic
1202174362 Y:22084094-22084116 TTTCACCTGTAAAATAGAGATGG - Intronic
1202216998 Y:22502288-22502310 TTTCACCTGTAAAATAGAGATGG + Intronic
1202326189 Y:23693782-23693804 TTTCACCTGTAAAATAGAGATGG - Intergenic
1202544583 Y:25976272-25976294 TTTCACCTGTAAAATAGAGATGG + Intergenic