ID: 1130427894

View in Genome Browser
Species Human (GRCh38)
Location 15:83819870-83819892
Sequence CATAGTAATGCCCCTGATAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130427894 Original CRISPR CATAGTAATGCCCCTGATAC TGG (reversed) Exonic
917118940 1:171628967-171628989 CATTTTAATGCCACTGATAAAGG + Intergenic
918832853 1:189420521-189420543 CATAGTAATGGACCTGGTTCTGG - Intergenic
918843922 1:189583956-189583978 CAAAGTAATGCCCTTGAGAGTGG + Intergenic
921313486 1:213869118-213869140 AATAGTAATGCCTATGAAACTGG - Intergenic
1066290579 10:34010975-34010997 CATAGTAACTGCCCTGACACAGG - Intergenic
1069225018 10:65932274-65932296 CATAGTAATGACAATGAAACAGG - Intronic
1072012130 10:91311454-91311476 CATAGTGAAGCCCCAGATGCTGG - Intergenic
1077833699 11:5904134-5904156 CATATTATTGGCTCTGATACTGG - Intronic
1078043350 11:7889921-7889943 AATAGTAGTGCCTCTGCTACAGG + Intergenic
1078746217 11:14117930-14117952 CATAATAAAGCACCTGGTACAGG + Intronic
1084057061 11:66641374-66641396 CACAGCAATGCCCATGACACAGG - Intronic
1089075282 11:115733688-115733710 CAGAGGAAGGCCCCTGATAGAGG + Intergenic
1096488368 12:51999374-51999396 CTTAGTAAGGCCTCTGACACAGG + Intergenic
1096664438 12:53153669-53153691 CATGTTGGTGCCCCTGATACAGG - Intergenic
1098292344 12:68968609-68968631 CATTTTAATGCCCATGATGCAGG + Intronic
1098956517 12:76694724-76694746 CTTAGTCATGGCCCTCATACAGG - Intergenic
1109604308 13:64672143-64672165 TATACTAATGCCTCTGATGCAGG - Intergenic
1111338107 13:86847908-86847930 CAGAGTACAGCCCCTTATACTGG + Intergenic
1121626236 14:95387373-95387395 CATAGTAATGGCAATAATACAGG - Intergenic
1125726037 15:41868589-41868611 CATAGTCACGCACCTGATCCCGG + Exonic
1126954277 15:53914781-53914803 CATAGTCGTGAACCTGATACAGG + Intergenic
1128317102 15:66667857-66667879 CAGAATAATGCCCCTGCAACTGG + Intronic
1128534156 15:68478196-68478218 CATTGAGATGCCCCTGGTACTGG + Intergenic
1130427894 15:83819870-83819892 CATAGTAATGCCCCTGATACTGG - Exonic
1130823348 15:87518126-87518148 CATAGTATTGCACCTGACATGGG - Intergenic
1131151703 15:90051270-90051292 CATAGTAAGGACCCAGTTACTGG - Intronic
1136648790 16:31647342-31647364 CATACTAATTCCCCAGATACTGG + Intergenic
1138503865 16:57466505-57466527 CATCCTAAGGCCCCTGCTACTGG - Intronic
1141298526 16:82791971-82791993 AATTGTAATCCCCATGATACGGG - Intronic
1145871125 17:28274227-28274249 CATTTTAATGCACCTGACACCGG + Intergenic
1148349820 17:46932611-46932633 CATCTTAATGCACCTGACACTGG - Intronic
1165955725 19:39500823-39500845 CACAGAAATGTCCCTGGTACTGG + Intronic
1166135876 19:40776965-40776987 CATAGTAATCTCCCTGAACCTGG - Exonic
928146612 2:28783957-28783979 CCTACTGATGTCCCTGATACAGG + Exonic
931500967 2:62865915-62865937 CAGAGTAGTGCTCCTCATACAGG - Intronic
941249405 2:163143998-163144020 CATGGAAAAGCCCCTGATCCTGG - Intergenic
942602515 2:177656156-177656178 CATAGTCATGCACCTTATAATGG + Intronic
1172998864 20:39091366-39091388 CATATTAATTACCCTGAAACAGG - Intergenic
1173246175 20:41339375-41339397 AATACTGATGCCCCGGATACTGG - Intergenic
1174399533 20:50268483-50268505 CATAGGAATGAACCTGAGACAGG - Intergenic
1175236284 20:57514498-57514520 CAAAGTACTGGCCCTGATACTGG - Intronic
1183321188 22:37166181-37166203 CTTGGAAATGCCCCTGCTACTGG + Intronic
952310103 3:32180869-32180891 CACAGTAATGCCCCAGATTGAGG + Intergenic
965488593 3:169309115-169309137 CAAAGGAATTCCCCTGAAACCGG + Intronic
966273511 3:178137343-178137365 CATAGTCATGCCTCAGAAACTGG + Intergenic
970718500 4:18957492-18957514 AATAGAAATTCCCCTGATAAAGG + Intergenic
972260892 4:37407474-37407496 GATACTAATGCCACTGATCCAGG + Intronic
972471953 4:39414188-39414210 CATTTTTATGCCCCTCATACTGG - Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
986628845 5:9749400-9749422 CATAGTGATGTAGCTGATACTGG + Intergenic
987370395 5:17187678-17187700 TTCAGTAATGCCCCTGATCCAGG + Intronic
992498220 5:77314471-77314493 CATAGTAATACTCCTGAAATTGG - Intronic
994568123 5:101480107-101480129 CATATTATTGTCCCTGATATAGG - Intergenic
998314803 5:141173370-141173392 CATATTAATGTCCATGATAGCGG + Exonic
998937314 5:147243023-147243045 CATTTTAGTGCCCTTGATACTGG - Intronic
1008432517 6:51435786-51435808 TATAGTAATGCTCCTGAGAGAGG + Intergenic
1014580911 6:123136497-123136519 AGTAGTAATGCCAGTGATACTGG - Intergenic
1041854269 8:62432603-62432625 GATAGTGATTTCCCTGATACAGG - Intronic
1047843902 8:128785267-128785289 CATTGAAAAGCCCCTAATACAGG - Intergenic
1053135807 9:35649783-35649805 AACAGTCATGCCCCTGCTACGGG + Exonic
1056681874 9:88726008-88726030 CATAGAAATGCCTCTGAAATTGG - Intergenic
1194294740 X:92114042-92114064 CACATTGGTGCCCCTGATACAGG + Intronic
1200612236 Y:5338545-5338567 CATATTGGTGCCCCTGACACAGG + Intronic