ID: 1130430439

View in Genome Browser
Species Human (GRCh38)
Location 15:83842031-83842053
Sequence ATGGGGAGGCAGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3094
Summary {0: 1, 1: 40, 2: 89, 3: 363, 4: 2601}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130430439 Original CRISPR ATGGGGAGGCAGAAGGGGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr