ID: 1130431292

View in Genome Browser
Species Human (GRCh38)
Location 15:83849671-83849693
Sequence GACAAATGGCCTCCTGGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 605}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130431292_1130431295 -7 Left 1130431292 15:83849671-83849693 CCTTTACCAGGAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 35
4: 605
Right 1130431295 15:83849687-83849709 ATTTGTCTGCAATTTATGAATGG 0: 1
1: 0
2: 1
3: 20
4: 274
1130431292_1130431297 7 Left 1130431292 15:83849671-83849693 CCTTTACCAGGAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 35
4: 605
Right 1130431297 15:83849701-83849723 TATGAATGGCCCATTCTGAAGGG 0: 1
1: 0
2: 1
3: 13
4: 130
1130431292_1130431300 26 Left 1130431292 15:83849671-83849693 CCTTTACCAGGAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 35
4: 605
Right 1130431300 15:83849720-83849742 AGGGTAAGATAAAGAAAGCGTGG 0: 1
1: 0
2: 2
3: 30
4: 395
1130431292_1130431296 6 Left 1130431292 15:83849671-83849693 CCTTTACCAGGAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 35
4: 605
Right 1130431296 15:83849700-83849722 TTATGAATGGCCCATTCTGAAGG 0: 1
1: 0
2: 0
3: 10
4: 177
1130431292_1130431301 27 Left 1130431292 15:83849671-83849693 CCTTTACCAGGAGGCCATTTGTC 0: 1
1: 0
2: 0
3: 35
4: 605
Right 1130431301 15:83849721-83849743 GGGTAAGATAAAGAAAGCGTGGG 0: 1
1: 0
2: 1
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130431292 Original CRISPR GACAAATGGCCTCCTGGTAA AGG (reversed) Intronic
900201620 1:1410170-1410192 GAAATATGGCCTCGTGGGAAGGG + Intergenic
900234432 1:1580706-1580728 GAAATATGGCCTCATGGGAAGGG + Intergenic
902281727 1:15379599-15379621 GAAATATGGCCTCGTGGGAAGGG - Intronic
903746168 1:25588213-25588235 GAAATATGGCCTCGTGGGAAGGG + Intergenic
904269264 1:29338661-29338683 GAAATATGGCCTCGTGGGAAGGG - Intergenic
904272519 1:29359689-29359711 GAAATATGGCCTCGTGGGAAGGG + Intergenic
905227615 1:36489548-36489570 GAAATATGGCCTCGTGGGAAGGG - Intergenic
905628530 1:39505197-39505219 GAGATATGGCCTCATGGAAAGGG - Intronic
905762561 1:40572389-40572411 GAAATATGGCCTCGTGGGAAGGG + Intergenic
906402300 1:45513873-45513895 GAAATATGGCCTCGTGGGAAGGG + Intronic
906404173 1:45528464-45528486 GAAATATGGCCTCGTGGGAAGGG + Intergenic
906498212 1:46320655-46320677 GAAATATGGCCTCGTGGGAAGGG + Intergenic
906499335 1:46329907-46329929 GAAATATGGCCTCGTGGGAAGGG + Intergenic
907120821 1:52006607-52006629 GAAATATGGCCTCGTGGGAAGGG + Intergenic
907465911 1:54636698-54636720 GAAATATGGCCTCGTGGGAAGGG - Exonic
907573159 1:55502586-55502608 GAAAAATGTCCTCCAGTTAAAGG + Intergenic
908543099 1:65140159-65140181 GAAATATGGCCTCATGGGAAGGG + Intergenic
908660025 1:66425397-66425419 GAAATATGGCCTCATGGGAAGGG - Intergenic
909234115 1:73129879-73129901 GAAATATGGCCTCGTGGGAAGGG - Intergenic
909413185 1:75377449-75377471 GAAATATGGCCTCGTGGGAAGGG + Intronic
909413836 1:75382854-75382876 GAAATATGGCCTCGTGGGAAGGG + Intronic
909651788 1:77983452-77983474 GAAATATGGCCTCGTGGGAAGGG - Intronic
911010655 1:93277364-93277386 GAAATATGGCCTCGTGGGAAGGG - Intronic
911595467 1:99794168-99794190 GAGATATGGCCTCGTGGGAAGGG - Intergenic
911599877 1:99836386-99836408 GAGATATGGCCTCATGGGAAGGG - Intergenic
912229755 1:107778554-107778576 GAAAAATGCCCTGCTGGTACAGG - Intronic
912301053 1:108517809-108517831 GAAATATGGCCTCGTGGGAAGGG + Intergenic
912450891 1:109766982-109767004 GAGATATGGCCTCATGGGAAGGG + Intronic
912642438 1:111360303-111360325 GAAATATGGCCTCGTGGGAAGGG - Intergenic
912919759 1:113854671-113854693 GACAAATGGGCTCTGGGAAATGG - Intronic
912942600 1:114058516-114058538 GAAATATGGCCTCGTGGGAAGGG + Intergenic
914252446 1:145932796-145932818 GAGATATGGCCTCGTGGGAAGGG + Intergenic
914358303 1:146907827-146907849 GAGATATGGCCTCGTGGGAAGGG - Intergenic
914379934 1:147106692-147106714 GAGATATGGCCTCATGGGAAGGG - Intergenic
914495121 1:148189180-148189202 GAGATATGGCCTCGTGGGAAGGG + Intergenic
914924520 1:151872868-151872890 GAGATATGGCCTCCCGGGAAGGG + Intergenic
915397939 1:155600119-155600141 GAAATATGGCCTCGTGGGAAGGG - Intergenic
915401804 1:155627248-155627270 GAAATATGGCCTCGTGGGAAGGG - Intergenic
915402708 1:155635460-155635482 GAAATATGGCCTCGTGGGAAGGG - Intergenic
915480234 1:156179586-156179608 GAAATATGGCCTCGTGGGAAGGG + Intergenic
915890409 1:159768159-159768181 GAAATATGGCCTCATGGGAAGGG + Intergenic
916009387 1:160691149-160691171 GAAATATGGCCTCGTGGGAAGGG + Intronic
916010280 1:160699412-160699434 GAAATATGGCCTCGTGGGAAGGG + Intronic
916039396 1:160949405-160949427 GAGATATGGCCTCGTGGGAAGGG - Intronic
916048287 1:161017199-161017221 GAAATATGGCCTCGTGGGAAGGG + Intronic
916092213 1:161316262-161316284 GAAATATGGCCTCGTGGGAAGGG - Intronic
916103519 1:161413019-161413041 GAGATATGGCCTCATGGGAAGGG + Intergenic
918784870 1:188751824-188751846 GAAATATGGCCTCGTGGGAAGGG - Intergenic
919326117 1:196109318-196109340 GAAATATGGCCTCATGGGAAGGG - Intergenic
920629275 1:207635693-207635715 GAGATATGGCCTCATGGGAAGGG - Intronic
920796380 1:209141546-209141568 GAAATATGGCCTCGTGGGAAGGG + Intergenic
921019421 1:211222714-211222736 GAGATATGGCCTCATGGGAAGGG - Intergenic
922305411 1:224340194-224340216 GAAATATGGCCTCGTGGGAAGGG + Intergenic
922398553 1:225227203-225227225 GAGATATGGCCTCATGGGAAGGG - Intronic
922682012 1:227606637-227606659 GAGATATGGCCTCGTGGGAAGGG - Intronic
924666962 1:246083048-246083070 GAAATATGGCCTCCTGGGAAGGG + Intronic
924764177 1:247016365-247016387 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1063114131 10:3061851-3061873 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1063306250 10:4903568-4903590 GAGATATGGCCTCGTGGGAAAGG - Intergenic
1063453234 10:6165073-6165095 GAGATATGGCCTCCTGGGAAGGG - Intronic
1063530333 10:6824762-6824784 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1063531253 10:6833256-6833278 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1064525379 10:16250353-16250375 GAGATATGGCCTCATGGGAAGGG + Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065500552 10:26377467-26377489 GAGATATGGCCTCATGGGAAGGG - Intergenic
1065553741 10:26893833-26893855 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1066289358 10:33999680-33999702 GCAAAATGGCAGCCTGGTAAGGG - Intergenic
1066927261 10:41713549-41713571 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1067101437 10:43337566-43337588 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1068979059 10:63042198-63042220 GACAAATGGCCTTTGGGTAGTGG - Intergenic
1071916837 10:90302221-90302243 GAGATATGGCCTCGTGGGAACGG - Intergenic
1072669281 10:97417413-97417435 GAAATATGGCCTCGTGGGAAGGG - Intronic
1072947300 10:99821419-99821441 GAAATATGGCCTCGTGGGAAGGG - Intronic
1073286357 10:102391809-102391831 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1073467839 10:103704665-103704687 GACAAACGGGCTCCTGGCCAAGG + Intronic
1074509771 10:114101488-114101510 GCCACATGGCTTTCTGGTAAAGG - Intergenic
1075370469 10:121930520-121930542 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1076932452 10:133541638-133541660 GAAATATGGCCTCATGGGAAGGG - Intronic
1078327411 11:10391891-10391913 GAAATATGGCCTCGTGGGAAGGG - Intronic
1079262869 11:18900477-18900499 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1079769975 11:24446449-24446471 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1080518963 11:33049895-33049917 GAGATATGGCCTCCTGGGAAGGG - Intronic
1081014513 11:37859297-37859319 GACATACGGCCTCATGGGAAGGG + Intergenic
1082621709 11:55431358-55431380 GAAATATGGCCTCATGGGAAGGG + Intergenic
1082672958 11:56058017-56058039 GAAATATGGCCTCATGGGAAGGG + Intergenic
1083040571 11:59681522-59681544 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1083167864 11:60902545-60902567 CACAAATGGGCTGCTGGTAAGGG + Intronic
1083285406 11:61655591-61655613 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1083388048 11:62326960-62326982 GAAATATGGCCTCATGGGAAGGG + Intergenic
1083393046 11:62369068-62369090 GAGATATGGCCTCGTGGGAAGGG - Intronic
1083467603 11:62859098-62859120 GAAATATGGCCTCGTGGGAAGGG - Intronic
1083467836 11:62860694-62860716 GAGATATGGCCTCATGGGAATGG - Intronic
1083543123 11:63528553-63528575 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1083543420 11:63530896-63530918 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1084207411 11:67603936-67603958 GAAATATGGCCTCGTGGGAAGGG - Exonic
1084231703 11:67758247-67758269 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1084247401 11:67868546-67868568 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1084880089 11:72164737-72164759 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1087034892 11:93745269-93745291 GAGATATGGCCTCGTGGGAAGGG - Intronic
1087314129 11:96586493-96586515 GAAATATGGCCTCTTGGGAAGGG + Intergenic
1087723723 11:101695426-101695448 GAAATATGGCCTCGTGGGAAGGG + Intronic
1087724654 11:101703924-101703946 GAAATATGGCCTCGTGGGAAGGG + Intronic
1088032217 11:105265215-105265237 GAAATATGGCCTCATGGGAAGGG + Intergenic
1089471221 11:118721595-118721617 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1089472116 11:118729788-118729810 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1089517060 11:119039851-119039873 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1089785178 11:120902546-120902568 AACAAATGGCTTCCTGGACAGGG - Intronic
1091963874 12:4721814-4721836 GAAATATGGCCTCGTGGGAAGGG - Intronic
1092142258 12:6191883-6191905 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1092234527 12:6797999-6798021 GAGATATGGCCTCATGGGAAGGG - Intronic
1092249692 12:6886436-6886458 GAAATATGGCCTCGTGGGAAGGG - Intronic
1092437526 12:8462295-8462317 GAAATATGGCCTCGTGGGAAGGG + Intronic
1092455093 12:8636020-8636042 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1092559826 12:9600829-9600851 GAAATATGGCCTCGTGGGAAGGG + Intronic
1092645919 12:10571850-10571872 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1093650943 12:21645306-21645328 GAAATATGGCCTCGTGGGAAGGG + Intronic
1094389364 12:29932636-29932658 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1094623209 12:32099874-32099896 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1096420695 12:51454869-51454891 GAAATATGGCCTCGTGGGAAGGG - Intronic
1096577851 12:52565465-52565487 GACACATGGGCTCCTGGAGAGGG - Intergenic
1096863250 12:54545586-54545608 GACAGAGACCCTCCTGGTAAAGG - Exonic
1097076804 12:56400943-56400965 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1097330525 12:58328041-58328063 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1097331460 12:58336530-58336552 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1097350529 12:58543743-58543765 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1097399149 12:59108578-59108600 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1098247982 12:68540127-68540149 GACAAATGGCCCTTTGGTACTGG - Intergenic
1099654330 12:85469520-85469542 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1101520658 12:105479142-105479164 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1101556476 12:105814531-105814553 GACAAATGGGCCCCAGGGAAAGG - Intergenic
1102135447 12:110570401-110570423 GAAATATGGCCTCGTGGGAAGGG + Intronic
1103688437 12:122751449-122751471 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1103794317 12:123492969-123492991 GAAATATGGCCTCATGGGAAGGG + Intronic
1105209866 13:18251319-18251341 GAAATATGGCCTCCTGGGAAGGG + Intergenic
1105253250 13:18720354-18720376 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1105349127 13:19600581-19600603 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1105688729 13:22814235-22814257 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1105879521 13:24591927-24591949 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1105920313 13:24957128-24957150 GAAATATGGCTTCCTGGGAAGGG - Intergenic
1107700361 13:43041121-43041143 GAAATATGGCCTCGTGGGAAGGG - Intronic
1108163976 13:47672828-47672850 GCCAAAAGACCTCCTGGTACTGG + Intergenic
1108291652 13:48967862-48967884 GAAAAATGGCGTCTTGGTACAGG + Intergenic
1108352422 13:49599386-49599408 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1109132323 13:58602774-58602796 GAAAAATGGGCTCCTGGAAGTGG + Intergenic
1109959808 13:69615458-69615480 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1113946545 13:114047786-114047808 GTCACGTGGCCTCCTGGAAAAGG + Intronic
1114154446 14:20084951-20084973 GAAATATGGCCTCATGGGAAGGG + Intergenic
1114438148 14:22725267-22725289 GAAATATGGCCTCATGGGAAGGG - Intergenic
1114632394 14:24167534-24167556 GACAAGTGGCCTTGTGGTGAAGG - Intergenic
1114960746 14:27885467-27885489 GACAAATCTCCTCCAGGTAAGGG - Intergenic
1115898522 14:38118463-38118485 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1116464318 14:45214084-45214106 GAGATATGGCCTCGTGGGAAGGG + Intronic
1116481291 14:45393948-45393970 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1117365630 14:55024913-55024935 GAAATATGGCCTCGTGGGAAGGG + Intronic
1117884290 14:60343493-60343515 GACAAAAGGAGTCCAGGTAAGGG - Intergenic
1118352043 14:64979170-64979192 GAAATATGGCCTCGTGGGAAGGG - Intronic
1119826622 14:77661980-77662002 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1119841324 14:77795256-77795278 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1120611677 14:86648533-86648555 GACACACGGGCTCCTAGTAAAGG + Intergenic
1120641625 14:87020502-87020524 GAAATATGGCCTCCTGGGAAGGG + Intergenic
1120741129 14:88110168-88110190 GACACATGGCATCATGGGAATGG - Intergenic
1121673225 14:95729719-95729741 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1122232243 14:100312372-100312394 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1123052648 14:105553539-105553561 GAAATATGGCCTCATGGGAAGGG - Intergenic
1123088872 14:105732792-105732814 GAGATATGGCCTCATGGCAAGGG + Intergenic
1125922229 15:43531814-43531836 GGCAGAAGGCCTCCTGGGAAGGG + Intergenic
1126798909 15:52282629-52282651 CCCAAATGGCCTCCTGGTGCCGG - Intronic
1127423633 15:58833912-58833934 GAAATATGGCCTCGTGGGAAGGG - Intronic
1127781550 15:62320836-62320858 GCCAAATGGCCTCCTGAATATGG - Intergenic
1128063359 15:64748899-64748921 CACAAAAAGCCTCCTGGAAAAGG + Intronic
1129485869 15:75871436-75871458 GAAATATGGCCTCGTGGGAAGGG - Intronic
1129773936 15:78221652-78221674 GAGATATGGCCTCATGGGAAGGG - Intronic
1130431292 15:83849671-83849693 GACAAATGGCCTCCTGGTAAAGG - Intronic
1130531373 15:84749353-84749375 GACAGATGGCCTCCTGGCCTTGG + Intronic
1130944506 15:88540915-88540937 GAAATATGGCCTCGTGGGAAGGG + Intronic
1131274993 15:90973465-90973487 GAGATATGGCCTCGTGGGAAGGG + Intronic
1131775002 15:95785297-95785319 GAGATATGGCCTCATGGGAAGGG - Intergenic
1132440596 15:101860559-101860581 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1133013526 16:2928342-2928364 GAGATATGGCCTCATGGGAAAGG - Intronic
1133433007 16:5754970-5754992 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1133687429 16:8179343-8179365 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1134369641 16:13611114-13611136 GACAATTTGCCTCCTGGGGAAGG - Intergenic
1134483304 16:14636721-14636743 GAAATATGGCCTCTTGGGAAGGG - Intronic
1135577854 16:23599839-23599861 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1136930372 16:34412639-34412661 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1136974202 16:34999169-34999191 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1137072961 16:35923394-35923416 GAGAAATGGCCTCATGGGAAAGG - Intergenic
1137075487 16:35956137-35956159 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1137366587 16:47864822-47864844 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1140418892 16:74799975-74799997 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1140546619 16:75815877-75815899 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1143195772 17:5075261-5075283 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1143401393 17:6646741-6646763 GAGATATGGCCTCGTGGGAAAGG + Intronic
1143468961 17:7159434-7159456 GAGATATGGCCTCCTGGGAAAGG + Intergenic
1144200019 17:12932459-12932481 GACAAATGGCAGACTGGAAAAGG - Intronic
1144861162 17:18303326-18303348 GAGATATGGCCTCGTGGGAAGGG + Intronic
1144882395 17:18437246-18437268 GAAATATGGCCTCATGGGAAGGG + Intergenic
1145031046 17:19505536-19505558 GAAATATGGCCTCGTGGGAAGGG - Intronic
1145033083 17:19520068-19520090 GAGATATGGCCTCGTGGGAAGGG + Intronic
1145149839 17:20507140-20507162 GAAATATGGCCTCATGGGAAGGG - Intergenic
1146161777 17:30563776-30563798 GAAATATGGCCTCATGGGAAGGG - Intergenic
1146166669 17:30595048-30595070 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1146181430 17:30700623-30700645 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1146839472 17:36140416-36140438 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1147563019 17:41520430-41520452 GACAAAGCCCCTCCTGGTGAGGG - Exonic
1147838760 17:43355309-43355331 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1148073659 17:44922928-44922950 GACAAATTGCCTCCTGGCGTGGG + Intergenic
1148273718 17:46284196-46284218 GAAATATGGCCTCGTGGGAAGGG - Intronic
1149202352 17:54201937-54201959 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1149767373 17:59290518-59290540 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1150409341 17:64930385-64930407 GAAATATGGCCTCATGGGAAGGG + Intergenic
1150607056 17:66701685-66701707 TACAAATGGCCAACAGGTAAAGG + Intronic
1150630987 17:66880371-66880393 GACAAAAGCCCTGCTAGTAATGG + Intronic
1150686792 17:67327429-67327451 GAAATATGGCCTCATGGGAAGGG - Intergenic
1150840922 17:68604574-68604596 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1152177400 17:78796840-78796862 GACAAATGCCCTCATAGTAGTGG - Exonic
1152480910 17:80551790-80551812 GAAATATGGCCTCGTGGGAAGGG - Intronic
1152962956 18:90814-90836 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1153143466 18:2001396-2001418 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1153422091 18:4917862-4917884 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1155472124 18:26202416-26202438 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1156806104 18:41184232-41184254 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1157250182 18:46088676-46088698 GAGATATGGCCTCGTGGGAAGGG + Intronic
1157777180 18:50404791-50404813 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1159336730 18:67077366-67077388 GAAATATGGCCTCATGGGAAGGG - Intergenic
1159413020 18:68105825-68105847 GAAACATGGCCTCGTGGGAAGGG - Intergenic
1159477559 18:68942851-68942873 GAAACATGGCCTCGTGGGAAGGG - Intronic
1160593747 18:79960480-79960502 GAAATATGGCCTCATGGGAAGGG + Intergenic
1160675174 19:387035-387057 GAAATATGGCCTCGTGGGAACGG + Intergenic
1162280930 19:9697387-9697409 GAGATATGGCCTCATGGGAAAGG + Intronic
1162292393 19:9789941-9789963 GAGATATGGCCTCATGGGAAAGG - Intronic
1162668137 19:12232405-12232427 GAAATATGGCCTCGTGGGAAGGG - Intronic
1163203253 19:15783212-15783234 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1163884762 19:19955868-19955890 GAGATATGGCCTCATGGGAAGGG + Intergenic
1163885581 19:19961956-19961978 GAGATATGGCCTCATGGGAAGGG + Intergenic
1163907065 19:20156922-20156944 GAAATATGGCCTCATGGGAAGGG - Intergenic
1163937892 19:20466690-20466712 GAGATATGGCCTCATGGGAAGGG + Intergenic
1163986886 19:20961922-20961944 GAGATATGGCCTCATGGGAAAGG + Intergenic
1164049025 19:21568307-21568329 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1164122841 19:22283899-22283921 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1164153680 19:22575301-22575323 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1164154354 19:22581155-22581177 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1164208613 19:23078103-23078125 GAGATATGGCCTCATGGGAAGGG + Intronic
1164229926 19:23278157-23278179 GAGATATGGCCTCATGGGAAGGG - Intergenic
1164273289 19:23693052-23693074 GAAATTTGGCCTCCTGGGAAGGG + Intergenic
1164276613 19:23724223-23724245 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1164370358 19:27638172-27638194 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1164390422 19:27814958-27814980 GAGATATGGCCTCATGGGAAGGG + Intergenic
1164489024 19:28689894-28689916 GAAATATGGCCTCTTGGGAAGGG - Intergenic
1165295118 19:34920542-34920564 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1165508088 19:36247547-36247569 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1165523540 19:36332763-36332785 GAGATATGGCCTCATGGGAAGGG - Intergenic
1165574153 19:36799918-36799940 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1165595095 19:37006522-37006544 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1165606255 19:37107217-37107239 GAGATATGGCCTCATGGGAAGGG - Intronic
1165607189 19:37115778-37115800 GAGATATGGCCTCGTGGGAAGGG - Intronic
1165634801 19:37331754-37331776 GAAAGATGGCCTCGTGGGAAGGG + Intronic
1165652344 19:37502331-37502353 GAGATATGGCCTCCTGGGAAGGG - Intergenic
1165666212 19:37630527-37630549 GAAATATGGCCTCGTGGGAAGGG - Intronic
1165691404 19:37866540-37866562 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1165814245 19:38631715-38631737 GAAATATGGCCTCGTGGGAAGGG - Intronic
1165952043 19:39479848-39479870 GAAATATGGCCTCATGGGAAGGG + Intergenic
1165977431 19:39688967-39688989 GAGATATGGCCTCATGGGAAGGG - Intergenic
1166151195 19:40876917-40876939 GACAAAAGGCCTAATGGAAAGGG + Intronic
1166157221 19:40922808-40922830 GAGATATGGCCTCATGGGAAGGG - Intergenic
1166596381 19:44053710-44053732 GAGAGATGGCCTCGTGGGAAGGG - Intronic
1166653642 19:44594459-44594481 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1166659822 19:44639419-44639441 GAGAGATGGCCTCGTGGGAAGGG + Intergenic
1167336575 19:48889999-48890021 GAAATATGGCCTCGTGGGAAGGG + Intronic
1167336921 19:48892204-48892226 GAGATATGGCCTCGTGGGAAGGG - Intronic
1167344053 19:48934335-48934357 GAGATATGGCCTCGTGGGAAAGG + Intronic
1167814629 19:51869073-51869095 GAGATATGGCCTCGTGGGAAGGG + Intronic
1167818603 19:51906056-51906078 GAAATATGGCCTCGTGGGAAGGG + Intronic
1167824292 19:51958148-51958170 GAGATATGGCCTCATGGGAAGGG + Intergenic
1167824605 19:51960849-51960871 GAGATATGGCCTCTTGGGAAGGG - Intergenic
1167831289 19:52024846-52024868 GAGATATGGCCTCGTGGGAAGGG + Intronic
1167831487 19:52026573-52026595 GAGATATGGCCTCGTGGGAAGGG + Intronic
1167833119 19:52043496-52043518 GAAATATGGCCTCGTGGGAAGGG + Intronic
1167834057 19:52052086-52052108 GAGATATGGCCTCATGGGAAGGG + Intronic
1167867392 19:52339347-52339369 GAGATATGGCCTCATGGGAAGGG - Intronic
1167876923 19:52421539-52421561 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1167883833 19:52484432-52484454 GAAATATGGCCTCGTGGGAAGGG - Intronic
1167884048 19:52485900-52485922 GAAATATGGCCTCGTGGGAAGGG + Intronic
1167888344 19:52520199-52520221 GAGATATGGCCTCATGGGAAAGG - Intergenic
1167893192 19:52559058-52559080 GAGATATGGCCTCATGGGAAGGG + Intronic
1167910521 19:52698321-52698343 GAAATATGGCCTCATGGGAAGGG - Intergenic
1167913756 19:52724161-52724183 GAGATATGGCCTCGTGGGAAGGG - Intronic
1167928884 19:52847414-52847436 GAGATATGGCCTCATGGGAAAGG + Intronic
1167939656 19:52936426-52936448 GAGATATGGCCTCATGGGAAGGG + Intronic
1167951115 19:53028492-53028514 GAGATATGGCCTCATGGGAAGGG - Intergenic
1167997834 19:53420895-53420917 GAGATATGGCCTCATGGGAAGGG + Intronic
1168000747 19:53444139-53444161 GAGATATGGCCTCATGGGAAGGG + Intronic
1168002519 19:53460530-53460552 GAGATATGGCCTCATGGGAAAGG - Intergenic
1168003744 19:53468939-53468961 GAGATATGGCCTCGTGGGAAAGG - Intronic
1168006963 19:53498003-53498025 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1168052360 19:53838989-53839011 GAAATATGGCCTCATGGGAAGGG + Intergenic
1168358515 19:55718257-55718279 GAGATATGGCCTCATGGGAAAGG + Intronic
1168477410 19:56686616-56686638 GAGATATGGCCTCATGGGAAAGG - Intergenic
1168612241 19:57810669-57810691 GAGATATGGCCTCATGGGAAGGG + Intronic
1168614837 19:57829319-57829341 GAGATATGGCCTCATGGGAAAGG + Intronic
1168640294 19:58026758-58026780 GACAAAAGGCATCCTGGTCTGGG - Intergenic
926063883 2:9822013-9822035 GACAGATGGGCTGCTGGTGAGGG - Intergenic
926892518 2:17650321-17650343 GACAAAACCCCTCTTGGTAAGGG - Intronic
927637062 2:24824335-24824357 GACAAATGGCCTCATGGTTCCGG + Intronic
927869115 2:26612644-26612666 GGCAAATGGCCTCCTGGAAGAGG - Intronic
927891129 2:26750225-26750247 GAAATATGGCCTCGTGGGAAGGG + Intergenic
927963433 2:27254970-27254992 GACAAATGGACTGCAGGGAAAGG + Exonic
927992835 2:27460342-27460364 GAAATATGGCCTCGTGGGAAGGG + Intronic
928355870 2:30614054-30614076 GAAATATGGCCTCGTGGGAAGGG - Intronic
928990235 2:37225681-37225703 GAAATATGGCCTCGTGGGAAGGG + Intronic
929208100 2:39321524-39321546 GAAATATGGCCTCGTGGGAAGGG + Intronic
930786834 2:55279636-55279658 GAAATATGGCCTCGTGGGAAGGG + Intergenic
932585954 2:73029050-73029072 GTCAAGTGGCCTCCTGGGACCGG + Intronic
933838049 2:86261663-86261685 GAAATATGGCCTCATGGGAAGGG + Intronic
934489021 2:94745244-94745266 GAGATATGGCCTCATGGGAAGGG - Intergenic
934897364 2:98130450-98130472 GAAATATGGCCTCGTGGGAAGGG - Intronic
936157265 2:110056435-110056457 GAGATATGGCCTCGTGGGAAGGG + Intergenic
936187429 2:110315009-110315031 GAGATATGGCCTCGTGGGAAGGG - Intergenic
936378519 2:111963424-111963446 GAAATATGGCCTCGTGGGAAGGG - Intronic
937970168 2:127543158-127543180 GAGATATGGCCTCGTGGGAAGGG - Intronic
938270111 2:129962547-129962569 GAAATATGGCCTCGTGGGAAGGG - Intergenic
939212596 2:139195972-139195994 CACAAATGGCCACCTGGTATCGG + Intergenic
939476677 2:142695698-142695720 GAGATATGGCCTCGTGGGAAGGG - Intergenic
941673161 2:168316790-168316812 TAGAAATGGGCTCCTGATAAAGG - Intergenic
942626639 2:177908319-177908341 GACAAATTGCCCCCTGAGAATGG - Intronic
943838225 2:192542523-192542545 GAAATATGGCCTCATGGGAAGGG - Intergenic
944460012 2:199938627-199938649 GAAAAATGGCCACCAGATAATGG - Intronic
944581984 2:201139365-201139387 GAAATATGGCCTCATGGGAAGGG + Intronic
945175209 2:207037188-207037210 GAAATATGGCCTCGTGGGAAGGG + Intergenic
945299164 2:208199918-208199940 GAAATATGGCCTCGTGGGAAGGG + Intergenic
946051978 2:216870709-216870731 GACACGGGCCCTCCTGGTAAAGG - Intergenic
946780674 2:223190841-223190863 GAGATATGGCCTCGTGGGAAGGG + Intronic
947212734 2:227722811-227722833 GAGATATGGCCTCGTGGGAAGGG - Intergenic
947273416 2:228364224-228364246 GAAATATGGCCTCGTGGGAAGGG - Intergenic
947308712 2:228776767-228776789 GGCAACTGGCCTCCAGGTCAGGG + Intergenic
947520748 2:230844219-230844241 GAAATATGGCCTCGTGGGAAGGG - Intergenic
947619081 2:231577139-231577161 GAAATATGGCCTCGTGGGAAGGG + Intergenic
947730097 2:232423369-232423391 GAAATATGGCCTCATGGGAAGGG + Intergenic
947953556 2:234168647-234168669 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1168825743 20:812436-812458 GAGATATGGCCTCATGGGAAAGG - Intergenic
1170075806 20:12417583-12417605 CACAAATGCCCTCCTGGGAAAGG + Intergenic
1171256821 20:23694940-23694962 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1171264171 20:23756861-23756883 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1171291021 20:23983006-23983028 GAAATATGGCCTCGTGGCAAGGG + Intergenic
1171450758 20:25234420-25234442 GAGATATGGCCTCATGGGAAGGG - Intergenic
1171451887 20:25241612-25241634 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1171495334 20:25550944-25550966 GAGATATGGCCTCGTGGGAAAGG - Intronic
1171817898 20:29804786-29804808 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1171900334 20:30850494-30850516 GAAATATGGCCTCATGGGAAGGG - Intergenic
1172338435 20:34135954-34135976 GAGATATGGCCTCATGGGAAGGG + Intergenic
1172341175 20:34158970-34158992 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1172352317 20:34252728-34252750 GAGATATGGCCTCGTGGGAAAGG - Intronic
1172374389 20:34425364-34425386 GAGATATGGCCTCGTGGGAAAGG + Intronic
1172479506 20:35262706-35262728 GAAATATGGCCTCGTGGGAAGGG - Intronic
1172716497 20:36968198-36968220 GAGATATGGCCTCATGGGAAGGG + Intergenic
1173319063 20:41971259-41971281 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1175057614 20:56212395-56212417 GAGATATGGCCTCATGGGAAGGG - Intergenic
1175573483 20:60041763-60041785 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1176421530 21:6520052-6520074 GACAAATGGTCACCTAGAAAAGG - Intergenic
1176424439 21:6539397-6539419 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1176888161 21:14281526-14281548 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1177175157 21:17694798-17694820 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1177249116 21:18569259-18569281 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1178667269 21:34559464-34559486 TACAAATGCCCTGCTGGTAATGG + Intronic
1178840753 21:36135763-36135785 GAAAACTGGCCTCCTGGGAGGGG + Intronic
1179697020 21:43128368-43128390 GACAAATGGTCACCTAGAAAAGG - Intergenic
1179699932 21:43147712-43147734 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1179878470 21:44283435-44283457 GAGATATGGCCTCCTGGGAAGGG - Intergenic
1180333016 22:11550026-11550048 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1180333699 22:11556485-11556507 GAAATATGGCCTCATGGGAAGGG - Intergenic
1180766393 22:18348081-18348103 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1180779922 22:18514297-18514319 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1180812636 22:18771618-18771640 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1180837730 22:18939037-18939059 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1180838639 22:18947248-18947270 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1181006984 22:20018237-20018259 GCCAATTGGCCTCCTGGCATAGG + Intronic
1181184571 22:21093698-21093720 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1181198795 22:21205866-21205888 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1181400945 22:22649933-22649955 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1181534880 22:23536425-23536447 GAAATATGGCCTCTTGGGAAGGG + Intergenic
1181594834 22:23907447-23907469 GAAATATGGCCTCATGGGAAGGG + Intergenic
1181618179 22:24069674-24069696 CCCCAGTGGCCTCCTGGTAAAGG + Intronic
1183627262 22:39012119-39012141 GAGATATGGCCTCATGGGAAGGG - Intergenic
1184089097 22:42283248-42283270 GACAAATGGCCTGCTGGAGGTGG + Intronic
1184818069 22:46887149-46887171 GGCAGATGGCCTCATGGGAAGGG + Intronic
1203228010 22_KI270731v1_random:88971-88993 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1203287821 22_KI270734v1_random:164336-164358 GAAATATGGCCTCGTGGGAAGGG + Intergenic
949547171 3:5082178-5082200 GAAATATGGCCTCGTGGGAAGGG - Intergenic
950030393 3:9848264-9848286 GAAATATGGCCTCGTGGGAAGGG - Intronic
950031098 3:9854211-9854233 GAAATATGGCCTCGTGGGAAGGG - Intronic
950607117 3:14091767-14091789 GAAATATGGCCTCGTGGGAAGGG - Intergenic
950629542 3:14273207-14273229 GAAATATGGCCTCGTGGGAAGGG + Intergenic
951514655 3:23545245-23545267 GAAATATGGCCTCGTGGGAAGGG - Intronic
952905121 3:38134842-38134864 GAGATATGGCCTCGTGGGAAGGG + Intronic
953029160 3:39166203-39166225 GACCAGTGGCCTCCTGTTGAAGG + Intergenic
953481878 3:43258880-43258902 GAGATATGGCCTCGTGGGAAGGG - Intergenic
953767798 3:45757339-45757361 GAGATATGGCCTCATGGGAAGGG - Exonic
953960083 3:47259897-47259919 GAAATATGGCCTCGTGGGAAGGG + Intronic
954440667 3:50520245-50520267 GAAATATGGCCTCGTGGGAAGGG + Intergenic
954896299 3:53978096-53978118 GAAATATGGCCTCGTGGGAAGGG - Intergenic
957048333 3:75393554-75393576 GAGATATGGCCTCCTGGGAAGGG + Intergenic
958605255 3:96350338-96350360 GACAGAATGCCTCCTGGTCAGGG + Intergenic
958943259 3:100336908-100336930 GAAATATGGCCTCGTGGGAAGGG - Intronic
958975775 3:100666722-100666744 GAAATATGGCCTCGTGGGAAGGG - Intronic
959069871 3:101692257-101692279 GAAATATGGCCTCGTGGGAAGGG + Intergenic
959070776 3:101700411-101700433 GAAATATGGCCTCATGGGAAGGG + Intergenic
959071304 3:101704415-101704437 GAAATATGGCCTCATGGGAAGGG - Intergenic
959263105 3:104104701-104104723 GACAATTGCCCACCTGGTAGTGG - Intergenic
959791488 3:110367417-110367439 GACATATGGCCTCATGGGAAGGG + Intergenic
959948575 3:112152612-112152634 GAGATATGGCCTCATGGGAAGGG - Intronic
959985282 3:112564661-112564683 GAAATATGGCCTCGTGGGAAGGG - Intronic
960027436 3:113024859-113024881 GAAATATGGCCTCGTGGGAAGGG - Intergenic
960028349 3:113033058-113033080 GAAATATGGCCTCGTGGGAAGGG - Intergenic
960510193 3:118540452-118540474 GAGATATGGCCTCGTGGGAAGGG - Intergenic
961296744 3:125890814-125890836 GAAATATGGCCTCATGGGAAGGG + Intergenic
961512597 3:127412244-127412266 GAAATATGGCCTCGTGGGAAGGG - Intergenic
961834032 3:129641677-129641699 GAAATATGGCCTCGTGGGAAGGG - Intergenic
961862877 3:129931587-129931609 GACAAATGTCCCCAGGGTAAAGG + Intergenic
961880405 3:130057650-130057672 GATATATGGCCTCCTGGGAAGGG + Intergenic
963535445 3:146522624-146522646 GAAATATGGCCTCCTGGGAAGGG + Intronic
966073360 3:175906132-175906154 GAAATATGGCCTCGTGGGAAGGG - Intergenic
966773042 3:183520960-183520982 GAGATATGGCCTCGTGGGAAGGG - Intronic
967025868 3:185563130-185563152 GAAATATGGCCTCGTGGGAAGGG - Intergenic
967026777 3:185571342-185571364 GAAATATGGCCTCGTGGGAAGGG - Intergenic
967179106 3:186887456-186887478 GAAATATGGCCTCGTGGGAAGGG - Intergenic
967179732 3:186893583-186893605 GAAATATGGCCTCGTGGGAAGGG + Intergenic
967418908 3:189251953-189251975 GAAATATGGCCTCATGGGAAGGG - Intronic
968095615 3:195928107-195928129 GAAATATGGCCTCGTGGGAAGGG - Intergenic
968221673 3:196944439-196944461 GAAATATGGCCTCGTGGGAAGGG + Intergenic
968387245 4:152324-152346 GAAATATGGCCTCGTGGGAAGGG - Intronic
968393032 4:208380-208402 GAGATATGGCCTCATGGGAAGGG - Intergenic
968396269 4:241562-241584 GAGATATGGCCTCGTGGGAAGGG + Intergenic
968695221 4:2021716-2021738 GAGATATGGCCTCGTGGGAAAGG + Intronic
968992794 4:3926004-3926026 GATATATGGCCTCCTAGGAAGGG + Intergenic
969822680 4:9732357-9732379 GATATATGGCCTCCTGGGAAGGG - Intergenic
970440437 4:16077028-16077050 GAAATATGGCCTCGTGGGAAGGG + Intronic
971026949 4:22598372-22598394 GAAATATGGCCTCGTGGGAAGGG - Intergenic
971204620 4:24552938-24552960 ATCAAATGGCCTCATGGTTAAGG - Intronic
973273586 4:48285945-48285967 GAAATATGGCCTCGTGGGAAGGG - Intergenic
974766944 4:66359340-66359362 GAAATATGGCCTCCTGGGAAGGG - Intergenic
974924644 4:68282040-68282062 GAGATATGGCCTCGTGGGAAGGG - Intergenic
974960509 4:68693831-68693853 GAGATATGGCCTCGTGGGAAGGG + Intergenic
975246839 4:72129806-72129828 GAAATATGGCCTCGTGGGAAGGG - Intronic
975679161 4:76858511-76858533 GACAAATGGCCCTCGGGAAAAGG - Intergenic
976057854 4:81089751-81089773 GACAAATATCCTCCTGAAAAGGG - Exonic
978342062 4:107729315-107729337 GAGATATGGCCTCGTGGGAAGGG - Intergenic
979141651 4:117183476-117183498 GAAATATGGCCTCGTGGGAAGGG + Intergenic
979200158 4:117967976-117967998 GACAATTGACCTCCTGGAAGTGG - Intergenic
979322735 4:119343114-119343136 GAAATATGGCCTCGTGGGAAGGG - Intergenic
979327471 4:119396728-119396750 GAAATATGGCCTCGTGGGAAGGG + Intergenic
980530508 4:134046599-134046621 GAGATATGGCCTCATGGGAAGGG - Intergenic
980638258 4:135538402-135538424 GAGATATGGCCTCGTGGGAAGGG + Intergenic
982512853 4:156305344-156305366 GAAATATGGCCTCGTGGGAAGGG - Intergenic
982823787 4:159977069-159977091 GAGATATGGCCTCGTGGGAAGGG - Intergenic
982876591 4:160659149-160659171 GAAATATGGCCTCATGGGAAGGG + Intergenic
983205460 4:164906096-164906118 GAAATATGGCCTCGTGGGAAGGG - Intergenic
983214498 4:164990746-164990768 GAGATATGGCCTCATGGGAAGGG + Intergenic
983215893 4:165002313-165002335 GAAATATGGCCTCGTGGGAAGGG + Intergenic
984012121 4:174383393-174383415 GAAATATGGCCTCGTGGGAAGGG + Intergenic
984287319 4:177748079-177748101 GACAAATGGCCTCTTGCACATGG - Intronic
984423433 4:179553758-179553780 GAAATATGGCCTCGTGGGAAGGG - Intergenic
985057800 4:186050413-186050435 GAAATATGGCCTCGTGGGAAGGG + Intergenic
985738085 5:1596559-1596581 GAAATATGGCCTCGTGGGAAGGG - Intergenic
986549620 5:8938104-8938126 GAAATATGGCCTCGTGGGAAGGG + Intergenic
987490852 5:18578818-18578840 GAAATATGGCCTCGTGGGAAGGG + Intergenic
988134459 5:27151509-27151531 GACAAATGTCCTTCTGGTCTAGG + Intergenic
988379991 5:30487235-30487257 GAAATATGGCCTCGTGGGAAGGG - Intergenic
988380912 5:30495731-30495753 GAAATATGGCCTCGTGGGAAGGG - Intergenic
988797688 5:34667035-34667057 GAGAAATGGCCCCTTGGAAAGGG + Intronic
989085505 5:37672256-37672278 GAGATATGGCCTCGTGGGAAGGG + Intronic
989108397 5:37885163-37885185 GACATATGGTCTCCTGGGACAGG - Intergenic
989583803 5:43058501-43058523 GAGACATGGCCTCGTGGGAAGGG + Intergenic
989640750 5:43580784-43580806 GAAATATGGCCTCCTGGGAAGGG + Intergenic
989737922 5:44731069-44731091 GAAATATGGCCTCGTGGGAAGGG - Intergenic
989836529 5:46000621-46000643 GAGATATGGCCTCGTGGGAATGG - Intergenic
989837411 5:46009519-46009541 GAGATATGGCCTCGTGGGAATGG - Intergenic
990414286 5:55571435-55571457 GAAATATGGCCTCGTGGGAAGGG + Intergenic
990789744 5:59464150-59464172 GAAATATGGCCTCGTGGGAAGGG + Intronic
992320211 5:75606415-75606437 GAAATATGGCCTCGTGGGAAGGG - Intergenic
993129529 5:83878051-83878073 TACAAATGGCCTCCTGCTTGAGG - Intergenic
993889567 5:93457192-93457214 GAAATATGGCCTCGTGGGAAGGG - Intergenic
994091235 5:95811375-95811397 GAGATATGGCCTCGTGGGAAGGG + Intronic
994532000 5:100983616-100983638 GAAATATGGCCTCGTGGAAAGGG - Intergenic
994936518 5:106259751-106259773 GAAATATGGCCTCGTGGGAAGGG - Intergenic
995740060 5:115346940-115346962 GAGACATGGCCTCATGGGAAGGG + Intergenic
995878850 5:116821494-116821516 GAAATATGGCCTCGTGGGAAGGG + Intergenic
996163418 5:120195266-120195288 GAAATATGGCCTCGTGGGAAGGG - Intergenic
999216930 5:149943076-149943098 GAGATATGGCCTCATGGGAAGGG - Intronic
999419253 5:151426752-151426774 GAGATATGGCCTCGTGGGAAGGG - Intergenic
999951711 5:156658288-156658310 GAAATATGGCCTCGTGGGAAGGG - Intronic
999952614 5:156666500-156666522 GAAATATGGCCTCGTGGGAAGGG - Intronic
1000064979 5:157686539-157686561 GAGATATGGCCTCATGGGAAGGG - Intergenic
1001232111 5:169997457-169997479 GAAATATGGCCTCGTGGGAAGGG - Intronic
1002482805 5:179514545-179514567 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1005126794 6:22455254-22455276 GACAGATTCCCTCCTGGTTATGG - Intergenic
1005525307 6:26641854-26641876 GAGATATGGCCTCGTGGGAAGGG + Intronic
1005638751 6:27775042-27775064 GAAATATGGCCTCTTGGGAAGGG - Intergenic
1005644217 6:27826238-27826260 GAAATATGGCCTCTTGGGAAGGG - Intergenic
1005729431 6:28682740-28682762 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1006238562 6:32657708-32657730 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1006250409 6:32778649-32778671 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1006538463 6:34720042-34720064 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1007793534 6:44328624-44328646 GAAATATGGCCTCGTGGGAAGGG - Intronic
1008565297 6:52762193-52762215 GAAATATGGCCTCGTGGGAAGGG + Intronic
1008582981 6:52923035-52923057 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1010591464 6:77717527-77717549 GAAATATGGCCTCGTGGGAAGGG - Intronic
1010592401 6:77725989-77726011 GAAATATGGCCTCGTGGGAAGGG - Intronic
1010686410 6:78859151-78859173 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1011536549 6:88381951-88381973 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1011693480 6:89891183-89891205 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1012136295 6:95561203-95561225 GAGATATGGCCTCCTGGGAAGGG - Intergenic
1013555789 6:111255670-111255692 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1014396639 6:120931817-120931839 GAAATATGGCCTCATGGGAAGGG + Intergenic
1014800836 6:125776431-125776453 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1015285221 6:131479022-131479044 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1015574787 6:134659692-134659714 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1015878129 6:137844833-137844855 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1017102567 6:150861828-150861850 GAGATATGGCCTCATGGGAAAGG + Intergenic
1017171118 6:151455792-151455814 GAAATATGGCCTCGTGGGAAGGG - Intronic
1017451621 6:154559419-154559441 GTCAAAAAGCCTCCTGGTGAAGG - Intergenic
1017785402 6:157752795-157752817 GAAATATGGCCTCATGGGAAGGG - Intronic
1018024679 6:159795313-159795335 GAAATATGGCCTCGTGGGAAGGG - Intronic
1019071247 6:169346867-169346889 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1019687541 7:2389987-2390009 GAGATATGGCCTCCTGGGAAGGG - Intergenic
1019976138 7:4583008-4583030 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1019977072 7:4591512-4591534 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1019978008 7:4600015-4600037 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1020315444 7:6902358-6902380 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1021067778 7:16198085-16198107 GAAATATGGCCTCGTGGGAAGGG + Intronic
1021671586 7:23040219-23040241 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1022164311 7:27742235-27742257 GAAATATGGCCTCGTGGGAAGGG - Intronic
1022599588 7:31744866-31744888 GACAAATTGCCTACTTTTAAAGG + Intergenic
1022997489 7:35772294-35772316 GAAAGATGGCCTTCTTGTAAAGG + Intergenic
1024932227 7:54675792-54675814 GAAATATGGCCTCTTGGGAAGGG - Intergenic
1025850979 7:65243615-65243637 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1025853655 7:65260737-65260759 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1026008660 7:66619540-66619562 GAAATATGGCCTCATGGGAAGGG - Intergenic
1029280446 7:99432119-99432141 GAGATATGGCCTCGTGGGAAGGG + Intronic
1029534768 7:101150435-101150457 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1029891458 7:103934375-103934397 GAATAATGGGCTCCTGGCAAAGG - Intronic
1030760307 7:113342099-113342121 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1031230206 7:119096080-119096102 GAAAAATGGATTCCTGGTCAGGG - Intergenic
1031344282 7:120645816-120645838 GACAAATGGCATCCTAATATAGG + Intronic
1031606981 7:123781000-123781022 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1031724601 7:125221752-125221774 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1031795421 7:126168523-126168545 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1032896307 7:136254563-136254585 GCAAAATGGCCTTCTGGCAAAGG + Intergenic
1033212123 7:139467768-139467790 GAAATATGGCCTCATGGGAAGGG + Intronic
1033349881 7:140553559-140553581 GAAATATGGCCTCCTGGGAATGG - Intronic
1033481958 7:141751497-141751519 GAAATATGGCCTCGTGGGAAGGG + Intronic
1033551701 7:142453261-142453283 GAGAAATGGCATTCTGGGAAAGG + Intergenic
1034146798 7:148880853-148880875 GTCAAAGTGCCTCCTGGTAGAGG - Intronic
1034428422 7:151027389-151027411 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1035349655 7:158237154-158237176 GAAATATGGCCTCGTGGGAAGGG + Intronic
1036291686 8:7498457-7498479 GAAATATGGCCTCGTGGGAAGGG - Intronic
1036292617 8:7506960-7506982 GAAATATGGCCTCGTGGGAAGGG - Intronic
1037429444 8:18794312-18794334 GAAATATGGCCTCGTGGGAAGGG + Intronic
1039392650 8:37193950-37193972 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1040027623 8:42796276-42796298 GAAATATGGCCTCGTGGGAAGGG - Intronic
1040126163 8:43740121-43740143 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1040413305 8:47176615-47176637 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1040587686 8:48758658-48758680 GACAAATGGCCCCCTGAGGATGG - Intergenic
1041060750 8:54032263-54032285 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1041374543 8:57200186-57200208 GAAATATGGCCTCGTGGGAAAGG - Intergenic
1042753113 8:72179914-72179936 AACAAATAGCCAGCTGGTAAAGG - Intergenic
1042986232 8:74586093-74586115 GTCCAATGGCATGCTGGTAAAGG - Intergenic
1043278993 8:78439137-78439159 GAAATATGGCCTCCTGGGAAGGG + Intergenic
1044310169 8:90684395-90684417 GAAATATGGCCTCGTGGGAAGGG + Intronic
1044310301 8:90685242-90685264 GAAATATGGCCTCGTGGGAAGGG + Intronic
1046334880 8:112772538-112772560 GAAATATGGCCTCGTGGGAAGGG + Intronic
1046939542 8:119917658-119917680 GAAATATGGCCTCGTGGGAAGGG + Intronic
1048728872 8:137414930-137414952 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1048947214 8:139460488-139460510 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1048989081 8:139750827-139750849 AACAAATGGACTCCTGGAGATGG - Intronic
1049557020 8:143287866-143287888 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1049667119 8:143850285-143850307 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1049776959 8:144410594-144410616 GAGATATGGCCTCATGGGAAAGG + Intronic
1049845017 8:144796257-144796279 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1050972516 9:11895104-11895126 AAAATATGGCCTCCTGGGAAGGG - Intergenic
1051471278 9:17445724-17445746 GAAATATGGCCTCGTGGGAAGGG + Intronic
1052279390 9:26715793-26715815 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1052676585 9:31633461-31633483 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1052871900 9:33515449-33515471 GAGACATGGCCTCGTGGGAAGGG - Intergenic
1054322243 9:63682191-63682213 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1054325678 9:63711163-63711185 GACAGATGTCCACCTGGTGACGG + Intergenic
1054843115 9:69763719-69763741 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1054866967 9:70012801-70012823 GACCAATGGACTCCTCCTAATGG + Intergenic
1055157953 9:73087789-73087811 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1056404666 9:86262209-86262231 CATAAATGGCATCCTGCTAAGGG - Intergenic
1056567320 9:87785545-87785567 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1057685701 9:97232506-97232528 GAGATATGGCCTCATGGGAAGGG + Intergenic
1058806250 9:108594968-108594990 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1059042151 9:110826611-110826633 GAAACATGGCCTCGTGGGAAGGG + Intergenic
1059143419 9:111875663-111875685 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1060167358 9:121429469-121429491 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1060220350 9:121761157-121761179 GACAAATGGGCTCCTGGACCAGG + Intronic
1061554247 9:131357074-131357096 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1061882097 9:133573721-133573743 GACTCATGGCCGCCTGGGAAGGG + Intronic
1061903487 9:133684831-133684853 GCCAAGTGACCTCCTGGAAACGG - Intronic
1061955273 9:133958136-133958158 GAAATATGGCCTCGTGGGAAGGG + Intronic
1061979514 9:134093018-134093040 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1062486754 9:136780913-136780935 GAGATATGGCCTCATGGGAAGGG - Intergenic
1062487818 9:136789393-136789415 GAGATATGGCCTCGTGGGAAGGG - Intergenic
1062489276 9:136796893-136796915 GAGATATGGCCTCGTGGGAAAGG + Intronic
1062556826 9:137116616-137116638 GAGATATGGCCTCGTGGGAAGGG + Intergenic
1185444742 X:251741-251763 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1185593338 X:1292879-1292901 GAGATATGGCCTCGTGGGAAGGG - Intronic
1187385777 X:18847071-18847093 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1188738303 X:33745356-33745378 TTCAAATAGCCTCATGGTAAGGG + Intergenic
1189824577 X:44904570-44904592 AACAAATGGCCTTCAAGTAAAGG + Intronic
1190227306 X:48556131-48556153 GATATATGGCCTCGTGGGAAAGG - Intronic
1190643155 X:52500235-52500257 GCCAAACGGGCTCCTGGAAATGG - Intronic
1190644517 X:52512632-52512654 GCCAAACGGGCTCCTGGAAATGG + Intronic
1191033334 X:55998352-55998374 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1191161624 X:57335737-57335759 GAAATATGGCCTCGTGGGAAGGG - Intronic
1191228013 X:58065918-58065940 GAGATATGGCCTCATGGGAAGGG - Intergenic
1192626433 X:72733548-72733570 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1192989476 X:76433301-76433323 TGCAAACTGCCTCCTGGTAAGGG + Intergenic
1194141302 X:90213695-90213717 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1197194014 X:123680026-123680048 GAGATATGGCCTCGTGGGAAGGG + Intronic
1197383847 X:125779874-125779896 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1198268194 X:135030709-135030731 GAGATATGGCCTCCTGGGAACGG + Intergenic
1198297694 X:135303319-135303341 GAAATATGGCCTCGTGGGAAGGG - Intronic
1198605621 X:138333850-138333872 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1198652149 X:138874689-138874711 GAGAAATGGCCTGCTGAAAAAGG - Intronic
1199896186 X:152129982-152130004 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1200181889 X:154155724-154155746 GACGAATGGCCTCCAGGCAGAGG - Intronic
1200187538 X:154192838-154192860 GACGAATGGCCTCCAGGCAGAGG - Intergenic
1200193188 X:154229978-154230000 GACGAATGGCCTCCAGGCAGAGG - Intronic
1200198943 X:154267782-154267804 GACGAATGGCCTCCAGGCAGAGG - Intronic
1200294974 X:154910697-154910719 GAGATATGGCCTCGTGGGAAGGG + Intronic
1200487056 Y:3782797-3782819 GAGATATGGCCTCCTGGGAAGGG + Intergenic
1200731643 Y:6749251-6749273 GAAATATGGCCTCGTGGGAAGGG + Intergenic
1200777208 Y:7180239-7180261 GAAATATGGCCTCATGGGAAGGG + Intergenic
1200833630 Y:7711702-7711724 GAGATATGGCCTCATGGGAAGGG + Intergenic
1201068728 Y:10124977-10124999 GAAATATGGCCTCATGGGAAGGG - Intergenic
1201356711 Y:13104404-13104426 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1201962748 Y:19700061-19700083 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1202253158 Y:22893621-22893643 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1202406148 Y:24527370-24527392 GAAATATGGCCTCGTGGGAAGGG - Intergenic
1202464634 Y:25142711-25142733 GAAATATGGCCTCGTGGGAAGGG + Intergenic