ID: 1130434607

View in Genome Browser
Species Human (GRCh38)
Location 15:83885346-83885368
Sequence TCATTAACACGATTGCATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130434607_1130434608 11 Left 1130434607 15:83885346-83885368 CCTGAATGCAATCGTGTTAATGA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1130434608 15:83885380-83885402 TTGCCTTTATTCTTGAAGACAGG 0: 1
1: 0
2: 1
3: 26
4: 319
1130434607_1130434610 22 Left 1130434607 15:83885346-83885368 CCTGAATGCAATCGTGTTAATGA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1130434610 15:83885391-83885413 CTTGAAGACAGGTGCAAAACTGG 0: 1
1: 0
2: 1
3: 9
4: 173
1130434607_1130434611 28 Left 1130434607 15:83885346-83885368 CCTGAATGCAATCGTGTTAATGA 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1130434611 15:83885397-83885419 GACAGGTGCAAAACTGGATTTGG 0: 1
1: 0
2: 0
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130434607 Original CRISPR TCATTAACACGATTGCATTC AGG (reversed) Intronic