ID: 1130435841

View in Genome Browser
Species Human (GRCh38)
Location 15:83898596-83898618
Sequence CCCATTTCTGCTCTTTCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 235}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130435841_1130435845 -6 Left 1130435841 15:83898596-83898618 CCACATGAAAGAGCAGAAATGGG 0: 1
1: 0
2: 2
3: 22
4: 235
Right 1130435845 15:83898613-83898635 AATGGGTAGCATCCAGGGATAGG 0: 1
1: 0
2: 0
3: 14
4: 180
1130435841_1130435847 3 Left 1130435841 15:83898596-83898618 CCACATGAAAGAGCAGAAATGGG 0: 1
1: 0
2: 2
3: 22
4: 235
Right 1130435847 15:83898622-83898644 CATCCAGGGATAGGAGGATTTGG 0: 1
1: 0
2: 1
3: 7
4: 147
1130435841_1130435846 -3 Left 1130435841 15:83898596-83898618 CCACATGAAAGAGCAGAAATGGG 0: 1
1: 0
2: 2
3: 22
4: 235
Right 1130435846 15:83898616-83898638 GGGTAGCATCCAGGGATAGGAGG 0: 1
1: 0
2: 2
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130435841 Original CRISPR CCCATTTCTGCTCTTTCATG TGG (reversed) Intronic
900594445 1:3474385-3474407 CCCATTTCTGCACATCCCTGGGG - Intronic
903392723 1:22976130-22976152 CCCAGTTCTGCCATTTCTTGGGG - Intergenic
903936122 1:26896290-26896312 TCCTTATCTGGTCTTTCATGTGG + Intronic
904714497 1:32457118-32457140 CCCATTCCCTCTCTTTCCTGGGG - Intergenic
904904590 1:33885567-33885589 CCCATTCCTGCTTCCTCATGTGG - Intronic
904948952 1:34220520-34220542 CCCATTTCTGCTTTTGTATATGG - Intergenic
905966521 1:42103070-42103092 ATGACTTCTGCTCTTTCATGTGG + Intergenic
906284246 1:44576335-44576357 TCCATCTCTGTTCTTTCAAGTGG - Intronic
907783566 1:57589940-57589962 CCAATTTGTGCTCTTTCAGGAGG - Intronic
907807920 1:57840063-57840085 CCTATTTCTCCTCTTTCTGGAGG - Intronic
908666080 1:66492841-66492863 CCCATTTTTAATCTTTCATCTGG - Intergenic
909342444 1:74547066-74547088 CCCATTTTTTCTCTTTCCTAGGG - Intergenic
911078268 1:93901593-93901615 TTCATTTCTTCTCTTTCATCAGG + Exonic
912527604 1:110295562-110295584 CCCGTTTCTGGAGTTTCATGAGG + Intergenic
919789625 1:201282936-201282958 CCCAAGTCTGCTCCTTGATGTGG + Intergenic
922071273 1:222196266-222196288 TTCATTTATGCTCATTCATGAGG + Intergenic
922078221 1:222268709-222268731 CCCATCTGTGCCCTTTCAAGAGG + Intergenic
923979447 1:239304612-239304634 CCCCTTTCTGCTCTTCCTTGGGG - Intergenic
924601749 1:245496351-245496373 CCCATTTTTGTTCTTTTATATGG - Intronic
1067268375 10:44767275-44767297 CCTATTTCTGCTCTTTCATTTGG + Intergenic
1067472597 10:46547641-46547663 GCCATTTGTTCTCTCTCATGTGG + Intergenic
1068128768 10:52871667-52871689 CCCATTTCTCCTCTGTCCTCTGG + Intergenic
1069245174 10:66195605-66195627 CCCAAGTTTGCTCTCTCATGTGG - Intronic
1069869913 10:71526840-71526862 CCCATCTCTGCTCTGTGACGTGG - Intronic
1070503850 10:77096100-77096122 CACCTTTCTTCTCTTTGATGTGG + Intronic
1071204593 10:83259555-83259577 CCCAATTCTTCACTTTCTTGAGG + Intergenic
1072846532 10:98837543-98837565 CCCATTTCTTCTCTCTCCTGAGG - Intronic
1075409569 10:122217333-122217355 CCCATTTCTGCCCATTTCTGAGG - Intronic
1075956168 10:126524975-126524997 ACCATTTCTGCCCTTGCAGGTGG + Intronic
1078564077 11:12398494-12398516 CTCATTTCTGCTCTTATAAGGGG - Intronic
1078936759 11:15958155-15958177 CCCATTTCTCCTCCTTCTGGAGG + Intergenic
1078988078 11:16613918-16613940 CCCTTTGCTTCTCTTTCAGGCGG - Intronic
1079566411 11:21888357-21888379 CCCATCTCACCTCTTCCATGTGG - Intergenic
1083627532 11:64079223-64079245 CCCCTTCCTGCTCTGGCATGTGG + Intronic
1084171664 11:67404051-67404073 CCTATGTCTCCTCTTTTATGGGG - Intronic
1085529438 11:77182810-77182832 CCCCTGTCTGCTCTGCCATGAGG - Intronic
1085695249 11:78698711-78698733 CCCATTTCTGGGCTATTATGAGG - Intronic
1089582439 11:119489726-119489748 TCCATTTCTGCCCTCTCATAGGG - Intergenic
1090644149 11:128753975-128753997 CCCAACTCTGCTCTTTCACTTGG + Intronic
1090952488 11:131485770-131485792 CCCATTTCAGCACTGGCATGTGG - Intronic
1091698683 12:2645284-2645306 CCCATCTGTGGTCTTTCTTGGGG - Intronic
1092622628 12:10289279-10289301 CTCTTTGCAGCTCTTTCATGAGG + Intergenic
1093269618 12:17044124-17044146 CCCTTTTCTTCTTTTTCCTGAGG - Intergenic
1094087084 12:26606003-26606025 CCAATTTCAGCTCTTTCAGAAGG - Intronic
1097866893 12:64566529-64566551 CTCAGTTCTGCTCAGTCATGAGG + Intergenic
1099526265 12:83722202-83722224 CCCAGTTCAACTCTTTCATTTGG + Intergenic
1101376399 12:104175053-104175075 CCCATATCTGCTCAGTAATGAGG + Intergenic
1105686826 13:22792364-22792386 CCCATTTCTGCTCTCTGCAGCGG - Intergenic
1106072288 13:26424398-26424420 CCCATTCCTCCTACTTCATGAGG - Intergenic
1106499294 13:30311767-30311789 CACATTTCTCCTCTGTCATCTGG + Intergenic
1109490143 13:63087147-63087169 CCCATTACTGATCTTTAAGGAGG + Intergenic
1110270762 13:73587399-73587421 CCCATTTGTGTTCTCTCCTGTGG + Intergenic
1111000593 13:82174810-82174832 CCCTTTTCTGTTTTTTAATGGGG - Intergenic
1111745833 13:92268316-92268338 CCCATTTCAGCCCTTTGATTTGG + Intronic
1113068091 13:106392018-106392040 GCCATTTCTCCTGTTTCAAGAGG - Intergenic
1113161735 13:107389394-107389416 CACATTTCTTCTTTTTCATAAGG - Intronic
1113830775 13:113293984-113294006 CCCATTACTGATCTTTGCTGTGG + Intergenic
1113887598 13:113669146-113669168 CCCCTTTCTGCACTTACATGGGG - Intronic
1116366957 14:44078308-44078330 CCCATTTCTGCTTTAACAGGGGG - Intergenic
1116665922 14:47775219-47775241 CCCATTTCTTCTTTTGCATCAGG + Intergenic
1116780157 14:49228097-49228119 CCCATTCCTGCAGTTTGATGAGG - Intergenic
1120734575 14:88038770-88038792 CCACTTTCTGCTGTTACATGAGG - Intergenic
1125177641 15:36843032-36843054 TGCATATGTGCTCTTTCATGAGG + Intergenic
1125807476 15:42506243-42506265 CCCATTTCTTTTCTTTCTTTGGG + Intronic
1128671423 15:69577195-69577217 TGCATTTCTGCTCCTTCCTGCGG + Intergenic
1128775617 15:70317848-70317870 TCCAGTTCTGCTATTTCTTGTGG + Intergenic
1130435841 15:83898596-83898618 CCCATTTCTGCTCTTTCATGTGG - Intronic
1133506889 16:6421245-6421267 CGCATCTCTGCTCTTCCATCTGG + Intronic
1133645037 16:7756093-7756115 CACATTTCTGCTTTTCCAAGTGG + Intergenic
1134107192 16:11493616-11493638 CCCTTGTGTGCTGTTTCATGGGG - Intronic
1134359572 16:13518590-13518612 CCCATTTCTGTCATTTCAGGTGG - Intergenic
1135161864 16:20103503-20103525 CCCAGTTTTGCTCTTTCAACTGG + Intergenic
1138121946 16:54407514-54407536 CCCATTTCTGGTATTTCTGGAGG + Intergenic
1138415247 16:56867889-56867911 CTGATATCTGCTCTTACATGGGG + Intronic
1138701745 16:58870408-58870430 CCAAATTCTGCTCTATCATAGGG + Intergenic
1140672324 16:77291566-77291588 CCCATCCCTCCTATTTCATGTGG - Intronic
1141802720 16:86322179-86322201 CCCTTTTCTTTTCTTTGATGGGG + Intergenic
1141867710 16:86762144-86762166 CCTTTTTCTGCTCTTCTATGGGG + Intergenic
1143996697 17:11012574-11012596 CGCAATTCTGCTCTTTCTGGTGG + Intergenic
1145107852 17:20134835-20134857 CCCTTTTCTCCTCTTCCATAAGG - Intronic
1145166419 17:20615988-20616010 CCCATATGTGGTCTTCCATGAGG - Intergenic
1148109815 17:45138012-45138034 CCCACTTCTGCCCTTTCCCGTGG + Intronic
1148507599 17:48140392-48140414 CTCAATTCTGCTTTTTAATGTGG + Intronic
1148867769 17:50637880-50637902 CCCATTTCAGCTGTTTGCTGGGG + Intronic
1149114995 17:53082709-53082731 ACTCTTTCTGCTCTTTCATGAGG - Intergenic
1151200952 17:72467759-72467781 CCCATTTCTGCTCTTCCTCTAGG + Intergenic
1156663825 18:39381368-39381390 ACAGTTTCTGCTCTTTCATTTGG + Intergenic
1156812878 18:41273936-41273958 CCCATCTGTGCTTTTTCAGGGGG + Intergenic
1158075246 18:53520507-53520529 TGCATCTCTGTTCTTTCATGGGG - Intronic
1158938704 18:62387644-62387666 TCCATTTCAGCTCTTTCACTGGG - Exonic
1159296775 18:66500504-66500526 CCCGTTCCTGCTATTTCAGGTGG + Intergenic
1159983337 18:74812987-74813009 CTCATTTCATCTCTTTGATGTGG + Intronic
1162617013 19:11810162-11810184 CTCATTGCTGCTCTGTCCTGTGG - Intergenic
1164065255 19:21709345-21709367 CCGATTTCTGCTCAGGCATGAGG + Intergenic
1164574096 19:29395514-29395536 CCCATGTCTGGCCTTCCATGTGG + Intergenic
1168422320 19:56212732-56212754 CCAATTCCTGTTCTCTCATGGGG + Intergenic
931586651 2:63837359-63837381 CCCCTTTTTCCTCTCTCATGTGG + Intergenic
932209227 2:69914195-69914217 CCGATTCCAGCTCTTTCTTGAGG + Intronic
932441932 2:71743079-71743101 CCCTTCTCTGCTTTGTCATGAGG - Intergenic
933921095 2:87046963-87046985 CTCATTTTTGCTTTTTAATGAGG - Intergenic
933930541 2:87146832-87146854 CTCATTTTTGCTTTTTAATGAGG + Intergenic
933975657 2:87507169-87507191 CCCTTTTATGTGCTTTCATGGGG - Intergenic
934001871 2:87722622-87722644 CTCATTTTTGCTTTTTAATGAGG + Intergenic
934052684 2:88223599-88223621 CCCATTTCCACTCCTTCATTGGG + Intergenic
934108202 2:88715796-88715818 CTATTTTCTCCTCTTTCATGAGG + Intronic
936318167 2:111443644-111443666 CCCTTTTATGTGCTTTCATGGGG + Intergenic
936362589 2:111818615-111818637 CTCATTTTTGCTTTTTAATGAGG - Intronic
937146803 2:119653918-119653940 ACCATTTCTCTTCTTTTATGAGG + Intronic
937885275 2:126895276-126895298 CCCATGTTTGTTCTTTCATTAGG - Intergenic
939215556 2:139233518-139233540 AGCATTTCTGTTCATTCATGTGG + Intergenic
939754815 2:146096569-146096591 ACCTTTTCTGCTCTTTCAGTTGG - Intergenic
940295982 2:152124504-152124526 ACCATTTTTGCTGTTTCCTGAGG - Intronic
940626747 2:156185029-156185051 CCCAGATCTGTTCTTTCATCTGG - Intergenic
944113256 2:196158612-196158634 TCCATTTATGAGCTTTCATGAGG - Intronic
945884099 2:215356397-215356419 CTAATTTTTGCTCCTTCATGAGG - Intergenic
947216437 2:227754299-227754321 CCCATATCTACTCCTACATGGGG + Intergenic
1169765650 20:9145077-9145099 CCCAGTTGTCCTCTTTAATGAGG - Intronic
1170663531 20:18365112-18365134 CCCATTCCTTCTTTTCCATGAGG - Intergenic
1170673368 20:18455621-18455643 CTCATTTGAGCTCTTCCATGTGG + Intronic
1171857477 20:30360703-30360725 CCCTTTTCTGCCCCCTCATGTGG + Intergenic
1173127085 20:40347325-40347347 CCACTTTCTGCTGTTTCATAAGG - Intergenic
1174063913 20:47851399-47851421 CCCAGTTCTTCTTTTTCATGAGG - Intergenic
1174407535 20:50311900-50311922 CACATTCCTGCGCTTTCGTGAGG - Intergenic
1174588053 20:51624073-51624095 CCCATTTCTGCTTCATCGTGGGG - Intronic
1177584751 21:23076160-23076182 CCCAGTTCTACAATTTCATGAGG - Intergenic
1177593305 21:23201958-23201980 CATATTTCTGCCCTTTCCTGTGG + Intergenic
1178170001 21:30029984-30030006 CCCTTTTCTGCTATTTTATTAGG + Intergenic
1179146916 21:38776036-38776058 CCCATTTCTCCTTTTCCCTGAGG + Intergenic
1179184446 21:39074081-39074103 CCCAAATCTGCTGGTTCATGGGG - Intergenic
1180390947 22:12281261-12281283 CCCTTTTCTGCCCCCTCATGTGG - Intergenic
1180408795 22:12583496-12583518 CCCTTTTCTGCCCCCTCATGTGG + Intergenic
1182546913 22:31081826-31081848 CCCATGTCTGTTCTTCTATGGGG - Intronic
1182955264 22:34418451-34418473 CCCATCTCTGCTCTTTCATTGGG - Intergenic
1183585437 22:38750618-38750640 CCCATTCCAGCACTTTCCTGTGG - Intronic
1183831640 22:40421218-40421240 CCCATTTCCACTCTTCCCTGTGG + Intronic
1184339397 22:43877892-43877914 CCCTTTTCTGCTCCATAATGTGG + Intergenic
1185213236 22:49583818-49583840 CCCATTTCTTCTCTTTCTTTTGG - Intronic
949380004 3:3433782-3433804 CCCATTGCTTCTCTTGCATGAGG + Intergenic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951129399 3:19023926-19023948 CCTGTTTCTGCACTCTCATGAGG + Intergenic
951372709 3:21870745-21870767 CCCATTTCTGCTCTGTGAACTGG + Intronic
951921923 3:27864466-27864488 CCAATTTTTGCTTTTGCATGTGG + Intergenic
952289129 3:31998257-31998279 CTCATTTCTTCCCTTTCATCTGG - Intronic
954793662 3:53150410-53150432 CCCATGAGTGCCCTTTCATGTGG + Intergenic
957044830 3:75365505-75365527 TCCATATCCTCTCTTTCATGTGG + Intergenic
957120466 3:76084094-76084116 CACTTTTGTGCTCTTTCGTGAGG + Intronic
957147272 3:76440627-76440649 CACATTTCTGCTCTTGGAAGGGG - Intronic
957587775 3:82154941-82154963 CCCTTGCCTGCTCTTTCATCTGG + Intergenic
959929625 3:111965221-111965243 CCATGTTCTTCTCTTTCATGTGG + Intronic
961717654 3:128869742-128869764 CCCATTTCTGCCCCTTCTGGAGG - Intergenic
962328858 3:134459826-134459848 CCCATTTCTGCTCTGATATGAGG + Intergenic
962918144 3:139926972-139926994 CCCTTCTCTTCTCTTTCATAGGG + Intergenic
963575337 3:147053768-147053790 CTGATTTTTGCTCTTTTATGGGG - Intergenic
963986605 3:151602741-151602763 CCCATCTTTGCTCTTTTAAGTGG + Intergenic
965859543 3:173131587-173131609 CCAATTTCTGGGCATTCATGGGG + Intronic
966274260 3:178145860-178145882 ACCATTTCTTCTCTTTCACAAGG - Intergenic
966963302 3:184963338-184963360 GCCTTTTCTGCTCTTTGGTGAGG + Intronic
967018367 3:185501295-185501317 CAAATTTCTACTCTTTCATCAGG + Intergenic
969090474 4:4690332-4690354 CCCAATCCTGCTATTTCATAGGG + Intergenic
970170605 4:13285624-13285646 CCCATGTCTGCTTTTTAATGAGG + Intergenic
971694303 4:29878303-29878325 TCCATTTCTGCTCCTTTCTGTGG - Intergenic
972140428 4:35952425-35952447 CACATATCTGCTCTTGTATGTGG - Intronic
974036763 4:56824249-56824271 CTCATTTCTGCTTTTTCAGCTGG - Intergenic
978161601 4:105555074-105555096 CCCATGTCTGCTCTCTTGTGTGG - Intronic
979202376 4:117993858-117993880 CCCATTTCTGTCTTTTCCTGGGG + Intergenic
981957503 4:150496347-150496369 TCTATTTTTGTTCTTTCATGAGG - Intronic
982738757 4:159035799-159035821 CCCACATCTGCTCTTCCAGGAGG + Intronic
982830026 4:160047447-160047469 CTTATTTCTCCACTTTCATGAGG - Intergenic
983303115 4:165952864-165952886 CCCATTCTTGCTCTTTAGTGGGG - Intronic
984958506 4:185070456-185070478 CCCATCTCTCCTCTTTCCTGTGG - Intergenic
985434496 4:189916144-189916166 CCCTTTTCTGCCCCCTCATGTGG + Intergenic
985676995 5:1237331-1237353 TCCATTTATGCTCTTCCATGTGG + Intronic
985999661 5:3620564-3620586 CCAATTTCTGCTTTGTCCTGGGG + Intergenic
986403915 5:7406571-7406593 CCCTTTTCTTCTGTTTTATGTGG + Intronic
987605839 5:20135031-20135053 CACCTTTCTTCTCTCTCATGGGG - Intronic
988042460 5:25907615-25907637 TCCCTTTCTGTTCTGTCATGGGG + Intergenic
988945491 5:36192994-36193016 AACATTTCTGCTCTGTGATGGGG - Intronic
989266214 5:39476977-39476999 CCCCTTTCTGCACATGCATGAGG + Intergenic
989956412 5:50366119-50366141 CCCATTCATGTTCTTTCCTGAGG - Intergenic
991412899 5:66362471-66362493 CCCATCTCTGTTCTTTCATTGGG + Intergenic
991927113 5:71716626-71716648 GCCATTGCTTCTCTTTCATGAGG + Intergenic
993484272 5:88463162-88463184 CTCATGTTTTCTCTTTCATGGGG + Intergenic
995767833 5:115638253-115638275 CCCAATTCTGGTCCTTCCTGAGG - Intergenic
996754150 5:126918407-126918429 ACCATATCTGCTGTTTCTTGTGG - Intronic
997655633 5:135552251-135552273 CCCATTTCTGTCCTTTCTTGTGG + Intergenic
998799591 5:145856063-145856085 CCCATTTCTGCCCTTGCCAGTGG + Intergenic
999153193 5:149440441-149440463 CGCACATCTGCTGTTTCATGTGG - Intergenic
1000480711 5:161770005-161770027 CCCCTTCCTGCTATTTCCTGTGG - Intergenic
1000989474 5:167897230-167897252 ACTATTTCTACTCTTTCATTTGG + Intronic
1003522361 6:6868914-6868936 CCCCTTCCTGCTCTTTCTTTGGG - Intergenic
1004618433 6:17312540-17312562 TCCATTCCTTCTCTGTCATGGGG + Intergenic
1006728591 6:36218117-36218139 CCCACTCCTGCTATTTCCTGAGG + Intronic
1007721209 6:43886400-43886422 CCCATCTCTGCTCCTCCCTGGGG - Intergenic
1008434855 6:51464090-51464112 CCCATGCATGCTCTTTTATGAGG + Intergenic
1008962022 6:57275778-57275800 TCCAATTCTACTTTTTCATGAGG - Intergenic
1014016069 6:116531532-116531554 CCCATTTTGGTTCTTTCATGGGG + Intronic
1015384863 6:132610486-132610508 CCAGTTTTTGCTCTTTCTTGGGG - Intergenic
1015860764 6:137677125-137677147 AGCATTTCTTCTCTTTCCTGTGG - Intergenic
1017423313 6:154295487-154295509 CCTCTTTCTGCTCATTGATGAGG + Intronic
1018009268 6:159655066-159655088 CCCATTTCTTCTCTTTTCTAGGG - Intergenic
1018526935 6:164722942-164722964 CCCATTTCTGTCCCATCATGAGG + Intergenic
1020049250 7:5071151-5071173 CCCATTTCTGCTTTTTAGAGGGG - Intronic
1020935709 7:14461133-14461155 ACCTTTCCTGCTCTTTCCTGTGG - Intronic
1021014537 7:15516930-15516952 TCAATGTCTGTTCTTTCATGTGG - Intronic
1022747809 7:33190409-33190431 CATAATTCTGCTTTTTCATGTGG + Intronic
1023095661 7:36657278-36657300 CCCAGTTCTGTTCTTTCCTCGGG + Intronic
1028073044 7:86476353-86476375 CTCATTTCCCCTATTTCATGGGG + Intergenic
1029135728 7:98369591-98369613 CCCAGATCTGTTCTTTCCTGCGG + Intronic
1029460205 7:100689895-100689917 CCCCTTACTTCTCTTTCATGAGG + Intergenic
1030165352 7:106549060-106549082 CACATTTCTACTTCTTCATGTGG - Intergenic
1030493010 7:110262987-110263009 CACATCTCTGATTTTTCATGAGG - Intergenic
1031580165 7:123464436-123464458 CTCATCTCTTCTCCTTCATGAGG - Intronic
1031925209 7:127632376-127632398 GCCATGTCTTCTCTCTCATGTGG - Intergenic
1033169980 7:139075402-139075424 CCCATTTCAGCTCTTCCAGAAGG + Intronic
1033269273 7:139916178-139916200 ACCATTTCTGCTGAGTCATGTGG - Intronic
1034077474 7:148246106-148246128 CACCTTTCTGCTCTTTCACCTGG + Intronic
1034283568 7:149869954-149869976 CTCATGTGTGCTCTTTCAGGAGG - Intergenic
1034550579 7:151818075-151818097 CCCATTTCTGCACACTCAGGTGG - Intronic
1037261576 8:17015162-17015184 CCCATGTCTTCTTTTTAATGGGG + Intergenic
1038512004 8:28146775-28146797 CACATTTCTGTTCCTTAATGAGG + Intronic
1039792989 8:40890673-40890695 CAGTTTTCTGCTCCTTCATGTGG + Intronic
1040829255 8:51659676-51659698 CACATTTCTGCACATCCATGTGG - Intronic
1041258693 8:56001445-56001467 CCCATCACTACTGTTTCATGTGG + Intronic
1043154395 8:76759595-76759617 ACCATTTCTGCTCTTCCAGATGG - Intronic
1043912971 8:85885187-85885209 GCCATTTCTAAACTTTCATGAGG - Intergenic
1046202859 8:110950366-110950388 CCCATTTCTGGGATTTCAGGAGG + Intergenic
1047063362 8:121252483-121252505 CCTTTTTCTGCTCTTCCCTGGGG - Intergenic
1047344751 8:124016203-124016225 CCCATTCCTGCCTTTTCTTGTGG - Intronic
1047416764 8:124670940-124670962 CCCATTTCTTATATTTAATGCGG - Intronic
1048224685 8:132573926-132573948 TCCATTTCTTCTCCTTCCTGTGG - Intronic
1048701722 8:137098706-137098728 CCTATTTCTCTGCTTTCATGTGG + Intergenic
1053069220 9:35091330-35091352 CCCACTTCTGCTGTTGCATGCGG - Exonic
1053723576 9:40974236-40974258 CCCTTTTCTGCCCCCTCATGTGG + Intergenic
1054342386 9:63877760-63877782 CCCTTTTCTGCCCCCTCATGTGG - Intergenic
1055018428 9:71644115-71644137 ACCAGTTCTTCTATTTCATGGGG - Intergenic
1055238951 9:74160373-74160395 CCTTTTTGTGCTCTTTCCTGAGG - Intergenic
1057215228 9:93224210-93224232 CCCAGTTCTGCCCCTTCAAGGGG + Intronic
1058026455 9:100145581-100145603 CCCTTCTCTGCTTTTTCAGGGGG - Intronic
1058633401 9:107012491-107012513 CCCATATCAGCTTTTTCAGGAGG + Exonic
1059424020 9:114209654-114209676 CCCCTTTCTTCTCTTTCCTAGGG + Exonic
1059902193 9:118940604-118940626 TGCAGTTCTGCTATTTCATGGGG - Intergenic
1060376963 9:123124288-123124310 CACACTGCTGCTCCTTCATGGGG + Exonic
1061011011 9:127954705-127954727 CCCCATTCTGCTCTTACCTGTGG - Intronic
1061753081 9:132794165-132794187 CCCTTTTCTGCTCTTTCCTAGGG - Intronic
1061942328 9:133890441-133890463 CCCATTTCTGCTCTCCCAAGTGG - Intronic
1062117173 9:134815691-134815713 CCCATTTCCCCTCTTTCTGGTGG + Intronic
1203451588 Un_GL000219v1:121784-121806 CCCTTTTCTGCCCCCTCATGTGG - Intergenic
1185566216 X:1097385-1097407 CCCATTTCTGCTTCTTGCTGGGG + Intergenic
1186165857 X:6825320-6825342 CCCAATTCTCCTCGTTCATTTGG - Intergenic
1186325653 X:8473975-8473997 CACATCTTTGCTCTTTGATGTGG - Intergenic
1187473825 X:19592090-19592112 AGCATTTCTGGTCTTTCAGGAGG + Exonic
1188777013 X:34232151-34232173 TCCATTCTTGCTCTTTAATGTGG - Intergenic
1189315473 X:40052960-40052982 CCCATTTCTCCCCTTTCTGGGGG + Intronic
1191648163 X:63506397-63506419 CCCTTTTCTGCTCTTCCATTAGG + Intergenic
1192411494 X:70936965-70936987 CCTATTTATGCACGTTCATGTGG + Intergenic
1194578094 X:95638580-95638602 CCAATTTGTGCTCTTTCATTTGG - Intergenic
1195281283 X:103336469-103336491 CCCATTACTGCACTTTTCTGTGG - Intergenic
1197703698 X:129618546-129618568 CCCATTTCTGCCCATCCAAGAGG + Intergenic
1198849141 X:140947124-140947146 GCCATTTCTACTCTGGCATGTGG + Intergenic
1201436239 Y:13961693-13961715 CACATCTTTGCTCTTTGATGTGG + Intergenic