ID: 1130436666

View in Genome Browser
Species Human (GRCh38)
Location 15:83906547-83906569
Sequence CAGTAAATGTGGTTGAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130436666 Original CRISPR CAGTAAATGTGGTTGAATTC TGG Intronic
903713786 1:25347326-25347348 CAGGAAAATTGCTTGAATTCAGG - Intronic
906121469 1:43394975-43394997 CAGCAAATGTTCTTGATTTCAGG + Intronic
906351437 1:45063569-45063591 AAGCCAATGTGGTTGACTTCTGG - Intronic
908690194 1:66771060-66771082 CAGTAATTATGTATGAATTCAGG - Intronic
911828985 1:102526089-102526111 AATAAAAGGTGGTTGAATTCTGG + Intergenic
912522191 1:110253207-110253229 CAGTAAATGTGGTTGGAGATTGG - Intronic
914221119 1:145682742-145682764 CAGTAAATGAAGTAGAAATCGGG - Intronic
915437860 1:155922618-155922640 CAGTAAATGTGAATGAATTGAGG - Intronic
915679675 1:157568667-157568689 AAGGAACTGTGATTGAATTCTGG + Intergenic
916255873 1:162787810-162787832 CAGAAAATGTTGTTAAATTGTGG + Intergenic
916685047 1:167136642-167136664 CAAGAAAAGTGGTCGAATTCTGG - Intergenic
918808361 1:189080166-189080188 CAGTAAATGTTGCTGAATGTAGG - Intergenic
919612370 1:199760936-199760958 CAGTATCTGTATTTGAATTCTGG - Intergenic
919691268 1:200530596-200530618 CTGTAAATGTGCTTGATTTTAGG - Intergenic
919713021 1:200747124-200747146 CAGGAAAAGTGCTTGAATACAGG - Intronic
919986086 1:202676220-202676242 CAATAAATGTGGTTGAATGTGGG - Intronic
921511747 1:216039965-216039987 GAGGAAAAGTGGATGAATTCTGG - Intronic
924077425 1:240354632-240354654 CAGCAAATGTGGATGACTTTGGG - Intronic
1066722339 10:38353477-38353499 CAGAAAATGTTGTTAAATTGTGG + Intergenic
1068427616 10:56888060-56888082 CAGTAAATGAAGTAGAAATCAGG - Intergenic
1068431884 10:56943599-56943621 CAGAAAATGTGCTTGACATCTGG + Intergenic
1071584638 10:86807857-86807879 CAGGAAAACTGCTTGAATTCAGG - Intronic
1072517730 10:96202388-96202410 CAGTGAGAGTGGTTGGATTCTGG + Intronic
1073911777 10:108353807-108353829 AAGGAAATGTGGTTCAATTTTGG + Intergenic
1074942234 10:118246899-118246921 CAGTAAATCTGCTAGAAGTCAGG + Intergenic
1075137430 10:119796581-119796603 CAGAAAATATGGTTGAATAATGG + Intronic
1075688805 10:124381641-124381663 CAATAAAGGTGGCTGAATTATGG + Intergenic
1076766223 10:132635228-132635250 CTGTTGATGTGGTTGAATTGGGG + Intronic
1078353108 11:10611555-10611577 TTGTTAATTTGGTTGAATTCAGG - Intronic
1078758686 11:14234512-14234534 CAGAAAATGAGGTTAAATCCAGG + Intronic
1080516453 11:33026143-33026165 CAGTAAATGTGGCTAAAATATGG + Intronic
1085678077 11:78544055-78544077 CCTCAAATGTGGTTGGATTCTGG - Intronic
1086558203 11:88136794-88136816 CAGTAATTGTAGTTGAAATCAGG + Intronic
1087172615 11:95066304-95066326 AAGTAAATATGATTGGATTCAGG + Intergenic
1088151417 11:106749890-106749912 CAGTAAATATGATTGTATTAGGG + Intronic
1088489101 11:110369583-110369605 CAGGAGATTTGCTTGAATTCTGG + Intergenic
1088767950 11:113002982-113003004 CAGAAAATTGGGTTGAATTGAGG + Intronic
1089468575 11:118702694-118702716 AAATGAATGTGGTTGAATTCAGG - Intergenic
1089739820 11:120574697-120574719 CAATAAATGTGTTTGAATGAAGG + Intronic
1093327896 12:17802528-17802550 CAGTAATGGTGGTTGTATTGAGG - Intergenic
1095660197 12:44723707-44723729 CTGTAAATGTGGATGAAAACAGG - Intronic
1098964928 12:76777865-76777887 CAGTAAATCTCGTTTCATTCTGG - Intronic
1099121637 12:78696814-78696836 CAGTAAATGTTTTAAAATTCTGG - Intergenic
1104318728 12:127729419-127729441 CACAGAATGTGGGTGAATTCAGG - Intergenic
1105924429 13:24994526-24994548 CAGAAAAAGTGGTTGAATAAAGG + Intergenic
1107389232 13:39945748-39945770 CAGTCAATGGGGTTCATTTCTGG - Intergenic
1107664854 13:42678237-42678259 CAGAAAATGTGGAGGGATTCAGG - Intergenic
1108595983 13:51949885-51949907 TAGTAAATGTGGTTAAATGAAGG - Intronic
1108871729 13:54995637-54995659 CAGAAAGTGTGGTTGCTTTCAGG - Intergenic
1114271258 14:21101763-21101785 CAGGAAATGGGATTGAATGCAGG - Intronic
1115552182 14:34514483-34514505 CAGAAAATGTGTTTTAACTCAGG - Intergenic
1115935313 14:38545606-38545628 AAGAAAATGTGGTTTAATACTGG + Intergenic
1116427667 14:44810049-44810071 CATTAAATCTGTTTGAATACAGG - Intergenic
1118786741 14:69052247-69052269 CAGAAGATGTGGATGAATTCAGG - Exonic
1120273491 14:82343958-82343980 TAGTAAGTGTGGTGAAATTCAGG - Intergenic
1124030944 15:26011320-26011342 CAGTATATGTTGTTGTATTTTGG + Intergenic
1125189830 15:36977889-36977911 CAGTAAATGGAGTGGAATTCAGG - Intronic
1126018997 15:44380905-44380927 TAGTATATCTGTTTGAATTCTGG - Exonic
1130436666 15:83906547-83906569 CAGTAAATGTGGTTGAATTCTGG + Intronic
1130968139 15:88712096-88712118 CAGAAAAGGTGGTGGAATTCAGG + Intergenic
1131601012 15:93848877-93848899 AAGTAAATGTTGCTGAAGTCTGG + Intergenic
1132130011 15:99267659-99267681 AAGTAAATGTGGTACAGTTCTGG + Intronic
1135274729 16:21102327-21102349 CAGTAAATGCTGTTGAAGTTAGG - Intronic
1138721424 16:59086274-59086296 CAATAAATGTGAAAGAATTCAGG - Intergenic
1138831486 16:60380295-60380317 AAGAAAATGTGTTTGGATTCTGG + Intergenic
1139218520 16:65154275-65154297 CAATACATGTAGTTGATTTCAGG + Intergenic
1139507769 16:67407838-67407860 CAGTAAATGGTGTGGAATCCTGG + Intronic
1140021163 16:71240113-71240135 CAGCTAAAGAGGTTGAATTCTGG + Intergenic
1141931104 16:87203464-87203486 CAATCAAGGTGGTTGGATTCAGG - Intronic
1149071802 17:52552350-52552372 CAGAAAAAGTTGTTGAATTTAGG - Intergenic
1149488288 17:57062460-57062482 CAGGAAATGTGCTTGAACCCGGG - Intergenic
1151698292 17:75729327-75729349 CAGAAGATGTGGATGAGTTCCGG + Exonic
1152789042 17:82268410-82268432 CAGTAACTGTGGCTGCAATCTGG + Intronic
1153829099 18:8905039-8905061 CTGTAAAAGGGGTTGAGTTCTGG - Intergenic
1154317769 18:13319006-13319028 CAGTAACTGTTGGTGAACTCAGG + Intronic
1155856460 18:30839740-30839762 CAGGAAATTTGGGGGAATTCAGG - Intergenic
1156904780 18:42339762-42339784 TAGTAACTGTGGTTGTGTTCAGG - Intergenic
1157953691 18:52070046-52070068 CAGTAAATGTGGTAGAATCAGGG + Intergenic
1160020330 18:75175606-75175628 CATTACATGTGGGTGAATCCAGG + Intergenic
1160217331 18:76943958-76943980 CAGTAAGTGAGGTTGATTTATGG + Intronic
1164283222 19:23787514-23787536 CAGGAGAATTGGTTGAATTCGGG + Intronic
1165089771 19:33378528-33378550 CAGTAAATTTGGTTAAACTGTGG + Intronic
1165188859 19:34045319-34045341 CAGTAAATAAGGTAGAAATCAGG + Intergenic
1165262833 19:34635722-34635744 CAGTATTTCTGGGTGAATTCTGG + Intronic
1165292982 19:34904406-34904428 CAGTACAGGTGGTTAAATTCAGG + Intergenic
926281362 2:11449752-11449774 CACTAACTGGGTTTGAATTCTGG + Intronic
927050963 2:19328762-19328784 CAGTAAATGTTGCTGAATGAGGG + Intergenic
928199307 2:29237155-29237177 GATGAAAAGTGGTTGAATTCTGG - Intronic
930869641 2:56156942-56156964 CAGGAAAATTGGTTGAATCCAGG + Intergenic
933316086 2:80717077-80717099 CTATATATGTGGTTGAATCCTGG + Intergenic
934954245 2:98603697-98603719 CAGTATCTGTGTTTGAATTTTGG - Intronic
937998280 2:127711729-127711751 CTGTATATGTGGTTGAGTTAGGG - Intronic
938009764 2:127819705-127819727 CAGTGACTGTGGTTAACTTCTGG - Intergenic
938183516 2:129206854-129206876 CATTATCTGTGGTTGAATTGTGG - Intergenic
939130401 2:138229080-138229102 CTGGAAAGGTGGTTAAATTCAGG + Intergenic
939266079 2:139874416-139874438 AAATAAATGTTGTTTAATTCTGG - Intergenic
939570482 2:143834327-143834349 TAGGAAATGAGGTTGAAATCAGG - Intergenic
940088989 2:149895257-149895279 CAGTACATGCAGCTGAATTCAGG + Intergenic
940712492 2:157179109-157179131 TAGTAAATGTGGTTAAATGAGGG - Intergenic
940752678 2:157644792-157644814 CAGTAAATCTGGGTGGAATCTGG + Intergenic
941027533 2:160475218-160475240 CAGTAAATTTTGTTGAATAAAGG - Intronic
942303563 2:174585423-174585445 TATTAAATGTGTTTGCATTCTGG - Intronic
942424925 2:175849465-175849487 AAGTAATTGTGGTTAAATTAAGG + Intergenic
946534914 2:220616791-220616813 TAGTAAATGTGGTTGTATGAAGG - Intergenic
1169612526 20:7398037-7398059 CTGGAAATGTGCTTGAATACTGG - Intergenic
1170233781 20:14079574-14079596 CAGTAAGTGTTTCTGAATTCTGG - Intronic
1173510043 20:43620260-43620282 CAGTAAATAGGGATTAATTCAGG + Intronic
1174439228 20:50535841-50535863 CAGTACATATGGTTTAATTAAGG - Intronic
1178396081 21:32245011-32245033 CAATAAATGGAGTTGAAATCTGG + Intergenic
1178708572 21:34894467-34894489 CAGCAAGTGTGGTTAAATTGGGG + Intronic
1179982713 21:44904998-44905020 CAGTAAATGTGTTTGGCTTTGGG + Intronic
1181679841 22:24486643-24486665 CAGTACGTGTGGCTGAATTAGGG - Intergenic
950447244 3:13045416-13045438 CAGGAAATGTGGCTGAATGCAGG + Intronic
950586919 3:13899265-13899287 GAATAAAAGTGGTTGAATTTTGG + Intergenic
951479410 3:23143627-23143649 CAGCAAATATGCTTGAAGTCAGG + Intergenic
951686317 3:25348755-25348777 CACTAAATGTGTTGAAATTCAGG - Intronic
953174891 3:40541829-40541851 TATTAAAAGTGGTGGAATTCAGG - Intronic
953813731 3:46135815-46135837 CAGTAAATGGGGTGGAATGAAGG - Intergenic
955858104 3:63296326-63296348 AACAAAATGTGGCTGAATTCTGG + Intronic
956086521 3:65616904-65616926 CAGGAAAAGTGGTTGATTTTAGG + Intronic
956137734 3:66115586-66115608 CAGTTAATCTGATTGAATTAGGG - Intergenic
956263274 3:67368954-67368976 TAGTAAATGTAGTTAAATTGGGG + Intronic
956594078 3:70947574-70947596 CAATAAATGGGGTAGAATTTTGG - Intergenic
956629866 3:71305697-71305719 TAGGAAATGTGGCTGAATTTTGG - Intronic
956653060 3:71522937-71522959 CAGTTCATATAGTTGAATTCAGG - Intronic
959897507 3:111621033-111621055 CAGGACATGTGATTTAATTCTGG - Intronic
961020845 3:123505637-123505659 CTGTTAATGTGGCTGAATCCTGG - Intronic
961863773 3:129938726-129938748 CAGTAAGGGAGGATGAATTCAGG - Intergenic
962839883 3:139223770-139223792 TAGTAAATGTGGATGGAGTCAGG + Intronic
966422235 3:179745160-179745182 CAGAAAATGTTGATGATTTCTGG + Exonic
966948660 3:184796253-184796275 CAGGAAAACTGCTTGAATTCGGG - Intergenic
967242984 3:187459419-187459441 CAAGAACTGTGTTTGAATTCCGG - Intergenic
967846069 3:194044050-194044072 CAGACAATCTGGTTAAATTCTGG + Intergenic
970053909 4:11949322-11949344 CTATAAAGGTGGTTGAATTTTGG - Intergenic
970890733 4:21041483-21041505 AAGTAAATGTGTTTGGATTATGG + Intronic
971052661 4:22878544-22878566 CAATAAAGGTGTTTGAATTTTGG + Intergenic
971973719 4:33655772-33655794 AAGTCAATCTGTTTGAATTCCGG - Intergenic
974160130 4:58128045-58128067 CAGTAAAAGTGCTTTAAATCTGG + Intergenic
975473440 4:74794935-74794957 CATTCATTGTGGTTGACTTCAGG + Intergenic
976785996 4:88822046-88822068 TAGTAAATGTGGTTTATTTAAGG - Intronic
977193697 4:94032183-94032205 CTGAAAATGTGATTGAATACTGG - Intergenic
978156771 4:105498709-105498731 AAATAAATGTTTTTGAATTCAGG + Intergenic
981097401 4:140796068-140796090 CATAAAATGTGGTTGAAGTGAGG + Intergenic
981602154 4:146501891-146501913 CAGTAAACGTGATTGGATTCAGG - Intronic
981805046 4:148705469-148705491 TATTAAATGTGGCTGTATTCTGG + Intergenic
983136110 4:164082760-164082782 CACTAAATATGGTTAATTTCAGG - Intronic
984133758 4:175910763-175910785 CAGAAAAAGTTGTTGAACTCCGG - Intronic
985368904 4:189264070-189264092 CAGTAAATGGGGATGAAGTCAGG + Intergenic
986709695 5:10479835-10479857 CAGGAAAATTGCTTGAATTCAGG - Intergenic
987338837 5:16921589-16921611 CAGTAGATCTGGTGGAATTCAGG + Intronic
988392474 5:30653553-30653575 CCGTAGATGTGGTCGAATACAGG - Intergenic
989076877 5:37573354-37573376 CAGTAACTGAGGGAGAATTCGGG - Intronic
991348189 5:65692676-65692698 CAAGAAATGTGGTTGGATTCTGG + Intronic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
998324130 5:141263843-141263865 CAGAAGAATTGGTTGAATTCAGG + Intergenic
999377807 5:151098980-151099002 CAGTTAAGGTAGTTGCATTCTGG - Intergenic
999807700 5:155098415-155098437 CAGAGAATGTGGCTGAAGTCTGG + Intergenic
1000521418 5:162299643-162299665 CAGTAAATGGGCTTGCTTTCTGG + Intergenic
1002446223 5:179291620-179291642 CATTAAACGAGGTTGAATTCTGG + Intronic
1005148817 6:22723788-22723810 CAGTTAAGGTGGTTCAACTCAGG - Intergenic
1010322443 6:74528647-74528669 CAGTAAATGTGATTCAAAGCGGG + Intergenic
1010864401 6:80956310-80956332 AAGAAGATGTGGTTGATTTCAGG + Intergenic
1011501877 6:87999715-87999737 CTCTAAATATGGTTAAATTCTGG - Intergenic
1013905639 6:115214630-115214652 CAGTAAATGAAGTTCAGTTCTGG - Intergenic
1014853272 6:126367820-126367842 CAGTTGATGTGGGAGAATTCAGG + Intergenic
1016468988 6:144355058-144355080 CAGTGAATGAGGTAGAATTCTGG + Intronic
1017149201 6:151262949-151262971 AAGAAAATGTGCTTGAACTCTGG - Intronic
1020723980 7:11785708-11785730 CAATACATGTGAATGAATTCAGG - Intronic
1021013685 7:15504616-15504638 CATTAACTGAGGTTGAATTATGG - Intronic
1023201994 7:37708184-37708206 GAGGACATGTGGTTGAATCCAGG + Intronic
1023325809 7:39054543-39054565 AAGTAAATGTGAATGAATACAGG + Intronic
1024704623 7:51943432-51943454 CAGTCTATGTCGTTTAATTCGGG - Intergenic
1028095969 7:86761308-86761330 CAGTAAATGTAGGTCAGTTCAGG + Intronic
1029414575 7:100435062-100435084 CAGTAGCTGTGGCTGAAGTCAGG + Intergenic
1029790326 7:102836822-102836844 CTGTCAAAGTGGTTTAATTCAGG - Intronic
1030375475 7:108748307-108748329 AAATAAATGTGGTTGAATTTTGG + Intergenic
1030558818 7:111060538-111060560 GAGTAAAGCTGGTTGAGTTCTGG + Intronic
1030622199 7:111802166-111802188 CAGTAAGAGTGATTGAGTTCAGG - Intronic
1030795626 7:113783340-113783362 CAGTAATTGTGTTGTAATTCAGG - Intergenic
1031131091 7:117834145-117834167 CAGGAGAATTGGTTGAATTCAGG - Intronic
1031358612 7:120819935-120819957 CAGGAACTGTTGTTTAATTCTGG - Intronic
1032865170 7:135917593-135917615 CAGTAAGTCTAGTTGAAATCGGG + Intergenic
1032925472 7:136599300-136599322 AGGTGAATTTGGTTGAATTCTGG - Intergenic
1036943531 8:13073211-13073233 CAGTAAATGGGCTAGAAGTCAGG - Intergenic
1037738514 8:21586033-21586055 CAGTAAAAGCTGCTGAATTCAGG + Intergenic
1038244869 8:25846144-25846166 CAATAAAGGCGGTTCAATTCTGG + Intronic
1038400453 8:27280375-27280397 CAGTAAATGTGGTATAATCCAGG - Intergenic
1038821816 8:30958959-30958981 CAGGAAAAGTGCTTGAATTTGGG + Intergenic
1040607965 8:48953300-48953322 CAGTATATGTTGTTAAATTTTGG + Intergenic
1041096810 8:54358425-54358447 AATTCAATGTGGTTGAATTTTGG - Intergenic
1041571909 8:59346801-59346823 CAGTAAATGTAGCTGATGTCTGG + Intergenic
1044581577 8:93831003-93831025 CAGTAAATCTGGATGAAGCCAGG + Intergenic
1045065808 8:98443195-98443217 CTGACAATGTAGTTGAATTCAGG + Intronic
1045905028 8:107334682-107334704 CTGTAAATGTGGTTCACTTTTGG + Intronic
1046273058 8:111921113-111921135 CAGGAAATGTGTTTGAAATGTGG - Intergenic
1046516291 8:115266125-115266147 AAGTAATTGTGGTTGAATGTGGG + Intergenic
1051184690 9:14447496-14447518 CACTAAATGAGTGTGAATTCAGG + Intergenic
1054944058 9:70775727-70775749 CAATAAATCTGGTTGAGGTCAGG - Intronic
1055761089 9:79608950-79608972 CAGGGAATGTAGTTAAATTCAGG + Intronic
1060273136 9:122161633-122161655 CAGTGAAGGTGGTAGAATTTTGG + Intronic
1060878039 9:127097494-127097516 AAGGAAATGTGTTTGAATGCAGG - Intronic
1061748114 9:132754890-132754912 CAGGAAAAGTGCTTGAATCCAGG - Intronic
1187438736 X:19297388-19297410 CTGTAAATGTGATTTATTTCTGG + Intergenic
1192058490 X:67798383-67798405 CAATAAATGCTGTTGAATTACGG - Intergenic
1193024740 X:76833973-76833995 CTGTAAATGGGATTGCATTCTGG + Intergenic
1193962420 X:87942037-87942059 AAGGAACTGTGGTTGACTTCTGG - Intergenic
1196668084 X:118337317-118337339 TTGTAAATGGGGTTGAATTTGGG + Intergenic
1196856254 X:119988011-119988033 GAAGAAAAGTGGTTGAATTCAGG - Intergenic
1197632002 X:128871987-128872009 AAGTAAAGGTGGTTTAATTATGG - Intergenic
1200821142 Y:7583691-7583713 CAGAAAATGTGATTTATTTCTGG + Intergenic
1200876204 Y:8157259-8157281 CAGAAAATGTGCTTTATTTCTGG + Intergenic
1201057407 Y:10009535-10009557 CAGAAAATGTGTTTTATTTCTGG - Intergenic
1202069805 Y:20979195-20979217 CAGTAAAATCGCTTGAATTCAGG - Intergenic
1202103190 Y:21331993-21332015 CAGAAAATGTGATTCACTTCTGG + Intergenic
1202239160 Y:22749051-22749073 CAGAAAATGTGATTTATTTCTGG - Intergenic
1202392148 Y:24382818-24382840 CAGAAAATGTGATTTATTTCTGG - Intergenic
1202478636 Y:25287299-25287321 CAGAAAATGTGATTTATTTCTGG + Intergenic