ID: 1130443576

View in Genome Browser
Species Human (GRCh38)
Location 15:83978422-83978444
Sequence AGCCCAGCAGCCCCTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130443576 Original CRISPR AGCCCAGCAGCCCCTTCAGG AGG Intronic
900389369 1:2427372-2427394 AGCTCAGCCGCCCCTGCTGGTGG + Intronic
900522250 1:3111355-3111377 CCCCCAGCACCACCTTCAGGAGG - Intronic
900719920 1:4168980-4169002 ATCCCAGCAGCCCCAGGAGGTGG - Intergenic
901027270 1:6285255-6285277 TGCTCAGCATCCACTTCAGGAGG - Intronic
901166419 1:7224863-7224885 AGGGCAGCAGCCCATGCAGGTGG - Intronic
902299694 1:15493286-15493308 AGCCTCGCAGCCCCTTCTCGTGG + Intronic
902638015 1:17747757-17747779 AGCCCTGGGGACCCTTCAGGAGG + Intergenic
902872838 1:19324744-19324766 TGACCAGCTGCCCCTGCAGGTGG + Exonic
903175061 1:21575767-21575789 AGCCAAGCAGGCCCTGCATGAGG + Exonic
904093441 1:27960398-27960420 AGCCCAGCACCTCCGTCAGCTGG + Intronic
904330556 1:29755549-29755571 TGCCCTGCAGCCCCTGCTGGGGG - Intergenic
904419098 1:30379958-30379980 CTCCCAGCAACCCCCTCAGGTGG - Intergenic
904702840 1:32368356-32368378 AGCCCAGCTGTCCCCTCAGGAGG - Intronic
904833230 1:33319085-33319107 AGCACAGCATCTCCTTCAAGGGG - Intronic
906460271 1:46031132-46031154 AGGCCAGCAGCACCCTCAGGAGG + Exonic
906473776 1:46152905-46152927 AGCCCAGCAAGGTCTTCAGGAGG - Intronic
906478824 1:46187281-46187303 TGGCCAGCTGCCCCTTCAAGTGG - Intergenic
907405435 1:54251027-54251049 ACCCCAGCACCCACTTCAGCCGG - Intronic
914423748 1:147555098-147555120 TTCACAGCAGCCCCTTGAGGTGG + Intronic
919804799 1:201375217-201375239 TGCCCAGCTGCCCCTCCAGGTGG + Intronic
920340358 1:205271794-205271816 AGCCCCTCTGCCCCTGCAGGAGG + Exonic
920425339 1:205870552-205870574 AACCCAGCTGCCCCATCAAGAGG + Intergenic
920627249 1:207614105-207614127 AGCCCAGCATCACCTACAGAAGG - Intronic
920637195 1:207715020-207715042 AGCCCAGCATCACCTACAGAAGG - Intronic
922096834 1:222450053-222450075 AGCCCAGCAGCACCTTAACGAGG + Intergenic
922472006 1:225882535-225882557 AGCCCCGCAGCTCCTCCCGGAGG + Intergenic
922970461 1:229732141-229732163 AGCCCAACAGCCGCTGGAGGGGG + Intergenic
924047471 1:240046714-240046736 CTCCAAGCAGCCCCTTAAGGGGG + Intronic
924947874 1:248858171-248858193 AGCCCAGCCGCTCCTTGAGGAGG + Exonic
1066112245 10:32207666-32207688 AGCCCAGCAGCCCCACCTGGTGG + Intergenic
1066697374 10:38091124-38091146 AGCCCGGCATTACCTTCAGGAGG - Intergenic
1066995162 10:42556347-42556369 AGCCCAGCATTGCCTTCAGGAGG + Intergenic
1068455321 10:57247451-57247473 AGCCCTGCAGCAGCTTCTGGGGG - Intergenic
1068947653 10:62745424-62745446 GGCCCAGATGCCCCCTCAGGAGG - Intergenic
1069551750 10:69368858-69368880 AGCCCAGCACTCCTGTCAGGAGG - Intronic
1069954006 10:72038715-72038737 AGACCAGCAGCCCATTTTGGAGG - Intergenic
1070711216 10:78684542-78684564 AGTGCAGCAACCCCTTTAGGGGG + Intergenic
1070944347 10:80376372-80376394 TCCCAAGCAGCCCTTTCAGGGGG + Intergenic
1071633584 10:87233644-87233666 AGCCGAGCATCCCCAGCAGGGGG - Intronic
1071694767 10:87860285-87860307 AGCCCAACAGCAACATCAGGTGG - Exonic
1071804542 10:89102721-89102743 AGCCTAGCAGCCACTGGAGGTGG - Intergenic
1072948158 10:99829223-99829245 AGCCTAGCAGCCACTGGAGGGGG - Intronic
1073419778 10:103415157-103415179 ACCCCAAGAGACCCTTCAGGAGG - Intronic
1074703619 10:116112806-116112828 AGCGCTGGAGCCCCTCCAGGTGG - Intronic
1074815165 10:117137288-117137310 AGCCCAGCTGCCTCTCCCGGCGG + Intronic
1074817255 10:117151757-117151779 AGCACACAGGCCCCTTCAGGAGG - Intergenic
1075095371 10:119467708-119467730 AGACCAGCAGCCTCTCCTGGGGG + Intergenic
1076241865 10:128914887-128914909 AGCCCAGAAACACCTCCAGGTGG - Intergenic
1076367789 10:129933598-129933620 AGCCCAGCAGCCTCTGCAGGCGG + Intronic
1076658156 10:132037753-132037775 CACCCTGCAGCCCTTTCAGGAGG + Intergenic
1076720151 10:132388893-132388915 AGCCCCCGAGCCCCTGCAGGCGG - Intergenic
1076842272 10:133051597-133051619 GGCCCAGCAGCTCCCTGAGGAGG + Intergenic
1077077502 11:708176-708198 AGCCCTGCAGCCCTGGCAGGAGG + Intronic
1077354321 11:2108132-2108154 AGTCCAGCAGGACCTTCAGATGG - Intergenic
1077539194 11:3138706-3138728 AGCCCAGGAGCCTCACCAGGAGG - Intronic
1078070557 11:8106523-8106545 GAACCACCAGCCCCTTCAGGCGG - Intronic
1078433306 11:11303924-11303946 AGCCAGGCAGCCCCTCCAAGGGG - Intronic
1078456766 11:11481804-11481826 ACCCTAACAGGCCCTTCAGGAGG + Intronic
1078653374 11:13216315-13216337 AGCTCAGCAGCCTCCTCTGGTGG + Intergenic
1078870677 11:15341676-15341698 AGCCCATCCACCCCTTCAGGGGG + Intergenic
1081584624 11:44375907-44375929 AGCCCATCAGACCCCTAAGGAGG + Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1083437076 11:62649859-62649881 AGCACAGCAGCCCGAGCAGGTGG + Exonic
1084179255 11:67438399-67438421 GGCCCAGCTGCTCCTCCAGGCGG + Exonic
1084332916 11:68440152-68440174 AGCCCAACAGCCACTCTAGGAGG - Intronic
1084463170 11:69307553-69307575 AGCCCCGCAGCCCATGTAGGTGG + Intronic
1085732787 11:79013527-79013549 AGCCCAGCAGCCCAATCATGGGG + Intronic
1086751256 11:90496687-90496709 AGCCCAAAAGCTCCTTCAGCTGG - Intergenic
1086887960 11:92225512-92225534 CTCCCAGCCGCCCCTGCAGGTGG + Intergenic
1086970275 11:93073877-93073899 AGCCCAGCAGGCCCCTAAGAGGG - Intergenic
1088745481 11:112800968-112800990 GGCTCAGTAGCCCCTTCAGGAGG - Intergenic
1089073881 11:115721618-115721640 CCCCCAGCAGCCCCACCAGGGGG - Intergenic
1089365979 11:117921396-117921418 AGACCACCAGCTCATTCAGGGGG - Intronic
1089979849 11:122763329-122763351 GGCCCAGCAGCCCATATAGGAGG - Intronic
1090030348 11:123200924-123200946 AGCCCAGCAGGCCTTCCAGGAGG + Intergenic
1090923529 11:131229920-131229942 AGTCCCACAGCCCCTTCAGAGGG + Intergenic
1091389576 12:117844-117866 AGGCCAGAAGCCCCTGCAGGAGG - Intronic
1092030102 12:5276781-5276803 AAACAAGCAGCCCCTGCAGGTGG - Intergenic
1092193931 12:6537862-6537884 AGCCCAGGATGCCCTTGAGGGGG - Exonic
1094830202 12:34296674-34296696 TTCCCAGCAGCCCCTGCATGGGG + Intergenic
1094831212 12:34301139-34301161 TTCCCAGCAGCCCCTACGGGGGG + Intergenic
1094831311 12:34301560-34301582 TTCCCAGCAGCACCTACAGGGGG + Intergenic
1094833805 12:34312891-34312913 TTCCCAGCAGCCCCTTCATGGGG - Intergenic
1094834245 12:34314796-34314818 ATCCCAGCAGCCCCTGCGTGGGG - Intergenic
1094835308 12:34319413-34319435 TTCCCAGCAGCCCCTGCACGGGG - Intergenic
1094835804 12:34321488-34321510 TCCCCAGCAGCCCCTTCACGGGG - Intergenic
1094836609 12:34325064-34325086 TTCCCAGCAGCCCCTGCACGGGG - Intergenic
1094837679 12:34329763-34329785 ATCCCAGCAGACCCTGCAGGTGG - Intergenic
1095717695 12:45365630-45365652 AGCCTAGCAGCCACTGAAGGGGG - Intronic
1096585176 12:52615227-52615249 AGCCCAGCACCCACTGCTGGGGG + Intronic
1097042766 12:56165518-56165540 GGCCCAGCAGCCCCTGTTGGGGG + Exonic
1097693517 12:62756029-62756051 AGCCCAGGATGCCCTTGAGGGGG - Intronic
1100223957 12:92537757-92537779 TGCTCTGCAGCCTCTTCAGGAGG + Intergenic
1100341405 12:93683184-93683206 AGCCCAGCCTCCCCATCTGGTGG + Intronic
1101436666 12:104670123-104670145 AGGCCAGCAGGCCCTGCAGCAGG - Intronic
1102656257 12:114484855-114484877 CGCCCGGCAGCCCCGTCTGGGGG - Intergenic
1102941159 12:116943448-116943470 AGCCAAGCAGAGACTTCAGGAGG - Intronic
1104390538 12:128387867-128387889 AGGCCAGCTGCCCGTGCAGGCGG + Intronic
1104541139 12:129666005-129666027 AGCCCATCGGCCCATTTAGGTGG - Intronic
1105210616 13:18254728-18254750 GGCCCAGCAGCCCCTACTAGAGG + Intergenic
1106388080 13:29307581-29307603 AGCCCAGGATGCCCTTGAGGGGG - Intronic
1106663283 13:31824952-31824974 AAGCCAGCTGCCCCTTTAGGAGG - Intergenic
1108542587 13:51457307-51457329 AGGGCAGCAGCCACTTCAGACGG + Intergenic
1110539392 13:76690753-76690775 AGACCAGCTGCCCCTTCAAGAGG - Intergenic
1112337319 13:98525943-98525965 AGCCCAACTTCCCCTTCTGGGGG + Intronic
1113474162 13:110568157-110568179 TGCCCAGCAGCCCCATAAAGAGG - Intergenic
1113788771 13:113016456-113016478 AGCCCGGCAACCCCTCCACGTGG + Intronic
1114064987 14:19053176-19053198 CGCCCAGCGGCCAATTCAGGTGG - Intergenic
1114097274 14:19346826-19346848 CGCCCAGCGGCCAATTCAGGTGG + Intergenic
1117656753 14:57963423-57963445 AGCCCAGCAGCCCCTGGGGCTGG + Intronic
1118316520 14:64729332-64729354 GGCCCAGCAGCCCCTTGAGGGGG - Intronic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1120873707 14:89360231-89360253 GGCCCAGCTGCCCCTAAAGGAGG + Intronic
1122429038 14:101628474-101628496 AGCCCAGCGGCCCCTCCCCGGGG - Intergenic
1124250197 15:28102025-28102047 AGCCCTCCAGCCCCGTCATGGGG + Intergenic
1124666537 15:31597865-31597887 AGCCCAGCAGCCCCTCTATGGGG - Intronic
1128550845 15:68596970-68596992 AGCCCTGCTGGCCCTGCAGGAGG - Intronic
1130214258 15:81953389-81953411 AGCCCAACATCCTCTTCACGTGG + Intergenic
1130443576 15:83978422-83978444 AGCCCAGCAGCCCCTTCAGGAGG + Intronic
1130977373 15:88787904-88787926 AGCCCAGGTGCCTGTTCAGGAGG + Intergenic
1131218762 15:90562931-90562953 TGCCCAGCAGCCACTGCAAGGGG - Intronic
1131459619 15:92609137-92609159 AGCCCAGCAGCAACTGCAGGAGG - Intergenic
1132041363 15:98526957-98526979 AGCCCAGCCACCACTTTAGGAGG - Intergenic
1132412796 15:101597312-101597334 AGCCCAGTAGCTCTTCCAGGTGG - Intergenic
1132502323 16:290061-290083 TGGCCAGCAGGCCCTTCAGAGGG + Intronic
1132621384 16:869779-869801 TCCCCACCAGCCCCTTCAGTGGG + Intronic
1132788915 16:1674099-1674121 AGCCCAGCAGCCCCAGAAGATGG + Exonic
1133113162 16:3561742-3561764 TGCCCAGCAGCTCCATCACGGGG + Exonic
1133221231 16:4319989-4320011 GCCCCAGCAGCCCCTGCTGGGGG + Intronic
1133395289 16:5442285-5442307 AGAGCAGCAGCCCATTCATGCGG + Intergenic
1135929684 16:26726002-26726024 AGCACAGGAGCCCCAGCAGGTGG - Intergenic
1136371599 16:29840273-29840295 GGCCCTGCAGCCCCTGGAGGAGG + Exonic
1136478626 16:30527561-30527583 CGGCCAGAAGCGCCTTCAGGAGG + Intronic
1137260260 16:46821481-46821503 AGCCCAGAAATCCCTGCAGGAGG - Intronic
1137727257 16:50665285-50665307 AGCCCAGAAGCCCCAAAAGGCGG - Intergenic
1140037868 16:71384873-71384895 AGCCCATCAGCCCGTCCAGAAGG + Intronic
1140595252 16:76401425-76401447 AGCCCAAAAGCTCCTTCAGCTGG - Intronic
1141262556 16:82467176-82467198 AGCCCAGGAGCTCCTTGGGGTGG + Intergenic
1141555404 16:84833861-84833883 AGCCCAGCAGCCTTCCCAGGAGG + Intronic
1141586440 16:85036753-85036775 AGCCCAGCACCCCCTGCCCGGGG + Intronic
1141725773 16:85787374-85787396 AGGACAGCGGCCCCTGCAGGGGG - Intronic
1142292566 16:89199741-89199763 AGCCCAGCAGCCAGCCCAGGAGG + Exonic
1142364069 16:89640491-89640513 GGAGCAGCAGCCCCTGCAGGCGG + Intergenic
1142429045 16:90016566-90016588 GCACCAGCAGCCCCTGCAGGGGG - Intronic
1142890083 17:2937529-2937551 AGGCCAGCAGCACGTGCAGGAGG + Intronic
1142933479 17:3308324-3308346 GGCCCAGCAGCCTCTGCAGAGGG - Intergenic
1144948726 17:18982769-18982791 AGCCCAGGAGCCCCTGGAGTGGG + Intronic
1144998204 17:19285546-19285568 TGCGCAGCAGCCCCTGCAGGAGG - Intronic
1145413585 17:22694670-22694692 GGCCCAGCAGCCCCTGGAGCTGG - Intergenic
1145797104 17:27662022-27662044 ACCCCAACAGCCACCTCAGGAGG - Intergenic
1146010795 17:29192769-29192791 TGCCCCACAACCCCTTCAGGAGG + Intergenic
1146747505 17:35345565-35345587 AGCGCAGCACCCACCTCAGGAGG - Intergenic
1148086703 17:44997953-44997975 AGCCCAGAGGCCCCTGCAGGGGG + Intergenic
1150006658 17:61473967-61473989 AGCCCATCAGCCCACTCAAGAGG - Intronic
1150284952 17:63949333-63949355 AGGCCTGCAGCCCCTGCAAGGGG - Intronic
1150951184 17:69803372-69803394 AGCCCAGAAATCCCTTCATGTGG + Intergenic
1151147710 17:72056902-72056924 AGCTCAGCAGCACCTTCATGTGG + Intergenic
1151514300 17:74582217-74582239 AGACCAGCAGCCCCCTCACCAGG - Exonic
1152067935 17:78121699-78121721 CGGCCAGCAGCTCCTGCAGGCGG + Exonic
1152078322 17:78171729-78171751 AGGCCAGCACACCCTGCAGGGGG - Exonic
1152127950 17:78458732-78458754 AGCCCTGCTGCCGCTGCAGGGGG - Intronic
1152248535 17:79199265-79199287 CACCCACCAGCCCCTTCCGGTGG + Intronic
1152616092 17:81338571-81338593 GGCCCAGAAGCCTCTCCAGGTGG - Intergenic
1152690448 17:81715561-81715583 AGCCCAGCAACACCTTCTCGTGG - Exonic
1153625812 18:7021169-7021191 TGAACAGCACCCCCTTCAGGAGG + Intronic
1153937894 18:9947129-9947151 ACTCCAGCAGGTCCTTCAGGAGG - Intronic
1157549050 18:48568340-48568362 CTCCCAGCAGCCCCATGAGGTGG + Intronic
1157701635 18:49764537-49764559 GGCCCAGCATCCCCACCAGGAGG + Intergenic
1157788389 18:50507325-50507347 AGCCCAGCAGCAGCTGCAGTGGG - Intergenic
1158500428 18:57995907-57995929 AGCCCTCCTGCCCCTTCATGTGG - Intergenic
1159463476 18:68749656-68749678 AGCCCAAAACCCCCTTAAGGTGG - Intronic
1160779102 19:869977-869999 TGCCCAGCAGCCCTGTGAGGTGG - Intronic
1160986039 19:1839393-1839415 AGCCCTGCAGCCTCTTCCAGGGG + Intronic
1161861491 19:6801580-6801602 AACCCATCAGCCCCTTCATCAGG - Intronic
1162088013 19:8260098-8260120 AGCCCTGCAGCCCCACCAGCTGG - Intronic
1163152902 19:15425337-15425359 AGCCAAGCGGCCCCTGCAGGAGG - Exonic
1165079063 19:33297502-33297524 AGACCAGCAGCTCCTGGAGGAGG + Intergenic
1166378943 19:42344510-42344532 AGCCCCACAGCCCCTCCACGGGG + Exonic
1166531966 19:43548128-43548150 CGGCCAGCCGCCCCTCCAGGAGG + Intronic
1166747044 19:45146353-45146375 GGGCCAGCACCCCCGTCAGGCGG - Intronic
1166942378 19:46374677-46374699 AGCGCAGCAGCCCCAGAAGGGGG + Intronic
1167254552 19:48419424-48419446 TTCCCAGCAGCCCCTGGAGGGGG + Intronic
1167262947 19:48469326-48469348 CGCCCAACCGCCCCTTCAGTAGG - Exonic
1167348362 19:48960869-48960891 AGCCCAACAGCCGCTCCCGGAGG - Exonic
925064918 2:922278-922300 AGCCCGGAAGCACCTTCCGGAGG - Intergenic
925258147 2:2507296-2507318 GGCCCCTCAGCCCCTGCAGGAGG - Intergenic
925885937 2:8393749-8393771 AGGCCAGAAGCCCCTCAAGGCGG - Intergenic
927826063 2:26311057-26311079 AGCCCAGGAGCACCATGAGGGGG + Exonic
928173401 2:29017903-29017925 TGCCCAGCATCCCCATCAGCCGG + Exonic
928408901 2:31038597-31038619 AGCCTAGCAGCCACTAGAGGGGG - Intronic
928950475 2:36808975-36808997 AGCCCAGCTTACCCTTCAGATGG - Exonic
930124299 2:47783772-47783794 AGCCCAGCACCCCCACCTGGCGG - Intronic
934568450 2:95353354-95353376 ATCCCAGAAGGCCCTTCATGGGG - Intronic
934989536 2:98911621-98911643 CACCCACCAGCTCCTTCAGGTGG - Intronic
935737694 2:106119433-106119455 TTCCCCGCAGCCCCCTCAGGTGG - Intronic
937181937 2:120004344-120004366 AGCCTGGCAGCCCCTGGAGGAGG - Intergenic
940247962 2:151640251-151640273 AGCTCACCAGCCCCTGGAGGAGG - Intronic
940431504 2:153596032-153596054 AGCCCAGCTGAGCCTTCAGATGG - Intergenic
945470489 2:210223546-210223568 AGCCCCCCAGCCCATTCAGAGGG + Intronic
945833054 2:214809422-214809444 AGCGCAGCAGCTTCTCCAGGCGG + Exonic
945927129 2:215817201-215817223 AGCCCAGCAGCCCCATGACTTGG - Intergenic
946024910 2:216665829-216665851 AGCTCAGCAGTCCCTGCATGGGG + Intergenic
946406071 2:219492744-219492766 AGCGCAGCAGCACCTTGTGGCGG - Exonic
947542282 2:230987385-230987407 AGCCCGGCAGCGCCCTCTGGTGG + Intergenic
947744359 2:232499953-232499975 ACCCCAGCACCCCCATCAGATGG - Intergenic
948342704 2:237268280-237268302 ATCCCAGAAGCTCCTTCAGTGGG + Intergenic
948980545 2:241492245-241492267 ACCCCAGCACCCCCGTGAGGGGG + Intronic
1169309202 20:4521193-4521215 TTCCCAGCAGCCGCTCCAGGTGG - Intergenic
1170617268 20:17963970-17963992 AGACCAGGGGCCCATTCAGGAGG + Intronic
1170857508 20:20070745-20070767 AGCTCAGCAGCCACTGCATGAGG - Intronic
1171291754 20:23986419-23986441 GGCCCAGCAGCCCCTACTAGAGG + Exonic
1171328457 20:24317080-24317102 AGGCCAGCAGCTGTTTCAGGAGG + Intergenic
1172201863 20:33132395-33132417 AGACCAACAGCCCCTTCAATGGG + Intergenic
1173526364 20:43735915-43735937 AGCCCTCCTGCCCCTTCAGCAGG + Intergenic
1174303133 20:49596305-49596327 AGGCCAGCAGTGCCTGCAGGGGG + Intergenic
1175493594 20:59396111-59396133 TGCCCAGCAGCAGCTGCAGGAGG + Intergenic
1175944703 20:62553307-62553329 TGCGCAGCTGCCGCTTCAGGTGG + Intronic
1176110141 20:63407375-63407397 AGCCCAGCAGCCCCTTTTGCAGG - Exonic
1176151302 20:63592475-63592497 AGCCCAGGAGTCTCTGCAGGAGG - Intronic
1180483476 22:15775796-15775818 CGCCCAGCGGCCAATTCAGGTGG - Intergenic
1180514965 22:16132129-16132151 CGCCCAGCACCACCTGCAGGTGG - Intergenic
1180765634 22:18344674-18344696 GGCCCAGCAGCCCCTACTAGAGG - Intergenic
1180780675 22:18517705-18517727 GGCCCAGCAGCCCCTACTAGAGG + Exonic
1180813395 22:18775025-18775047 GGCCCAGCAGCCCCTACTAGAGG + Intergenic
1181017733 22:20080658-20080680 AGCCTAGCATCGCCTTCAGGCGG + Intronic
1181199570 22:21209342-21209364 GGCCCAGCAGCCCCTACTAGAGG + Exonic
1181400191 22:22646516-22646538 GGCCCAGCAGCCCCTACTAGAGG - Exonic
1181649175 22:24249274-24249296 GGCCCAGCAGCCCCTACTAGAGG + Intergenic
1181702164 22:24627614-24627636 GGCCCAGCAGCCCCTACTAGAGG - Exonic
1182317241 22:29456130-29456152 AGCCCTGCAGGACCTTCTGGGGG - Intergenic
1182453773 22:30436456-30436478 AGCCCAGCAGCCCCCTAGGGCGG + Intergenic
1183459395 22:37940860-37940882 AGCCCAGGAGCTGCTCCAGGAGG - Exonic
1183829355 22:40409681-40409703 GGCGCAGCAGCCCCTGAAGGAGG + Exonic
1183928274 22:41221233-41221255 AGCCCACCAGCCGTTTCATGAGG - Exonic
1184556091 22:45233880-45233902 AGCCCAGCACCGCATGCAGGAGG + Intronic
1184684399 22:46089609-46089631 CTGCCAGCAGCCCCTCCAGGTGG - Intronic
1184850068 22:47114986-47115008 TGCCCAGCAGGCCCTGGAGGTGG - Intronic
1185250355 22:49798626-49798648 AGCGCAGCAGCACCGTCAGCGGG + Exonic
1203227256 22_KI270731v1_random:85564-85586 GGCCCAGCAGCCCCTACTAGAGG - Intergenic
1203263497 22_KI270734v1_random:707-729 GGCCCAGCAGCCCCTACTAGAGG + Intergenic
950442847 3:13019874-13019896 CGCCCCACAGCCCCGTCAGGTGG + Intronic
950942397 3:16905967-16905989 AGCCCAAAAGCCTCTCCAGGTGG - Intronic
951055534 3:18142636-18142658 AGCCCCACAGCTCGTTCAGGTGG + Intronic
951591239 3:24267488-24267510 AGCCCAGGAGAGGCTTCAGGAGG - Intronic
952334366 3:32391996-32392018 GGTCCAGCAGCCCCTCCAAGGGG - Exonic
952395843 3:32919833-32919855 TTCCCAGCAGCCCCTTCAGCAGG - Intergenic
953069215 3:39502807-39502829 CGCGCAGCAGCCCCCTCAGAGGG + Exonic
954035179 3:47847475-47847497 AGTGCAGCAGCGCCTCCAGGAGG + Exonic
954659894 3:52221435-52221457 GGCCCAGCAGCGCCTGCTGGAGG - Exonic
957916758 3:86695927-86695949 CGCTCAGCAACCCCTGCAGGGGG + Intergenic
961006566 3:123409691-123409713 AGCCCAGCAAGCTCTCCAGGAGG + Intronic
961339378 3:126207277-126207299 GGCCCAGCTGAGCCTTCAGGTGG - Intergenic
961513937 3:127421176-127421198 AGCCCAGGAGCATCTACAGGAGG + Intergenic
961647211 3:128398909-128398931 CCTGCAGCAGCCCCTTCAGGAGG + Intronic
963123357 3:141794357-141794379 AGCCAAGTAGCCCCCACAGGTGG + Intronic
963597711 3:147348774-147348796 TGACCAGTGGCCCCTTCAGGAGG - Intergenic
964050772 3:152390453-152390475 CCTCCAGCAGGCCCTTCAGGAGG - Intronic
964066626 3:152587665-152587687 TTCCCAGCAGCCCCTGTAGGAGG + Intergenic
967619554 3:191616438-191616460 AGCCAAGCAGCCACTGGAGGTGG + Intergenic
967986167 3:195097024-195097046 CGCCCAGCAGACCCCTCAGACGG + Intronic
968445668 4:650953-650975 AGCCCAGCAGCCCCACCCTGAGG - Intronic
968912794 4:3484531-3484553 AGCCCAGTGGCCCATTCACGCGG + Intronic
969045579 4:4334217-4334239 ATCTCAAAAGCCCCTTCAGGAGG + Intergenic
970379515 4:15492906-15492928 AGCCCAGAATGCCCTTGAGGGGG + Intronic
970437427 4:16049009-16049031 AGCCCAGCCGCCCCATCATCAGG - Intronic
972087182 4:35233225-35233247 GGCCCAGAAGCTCCTTCAGCTGG - Intergenic
974472165 4:62332147-62332169 AGCCCAGTAGCTCCATTAGGTGG + Intergenic
975679144 4:76858364-76858386 AGCCTAGCAGCCACTGGAGGGGG + Intergenic
976628054 4:87207888-87207910 AGCCCAGGATGCCCTTGAGGGGG - Intronic
977512972 4:97984738-97984760 AGCGCAGCATCCCCAACAGGGGG - Intronic
980403610 4:132326329-132326351 AGCACAGCAGCACCTGCAGTTGG - Intergenic
983439099 4:167758131-167758153 AGCCCAAAAGCTCCTTCAGCTGG + Intergenic
985573803 5:664538-664560 CGCCCAGCACCCCCGCCAGGTGG + Exonic
985627153 5:995029-995051 AGGCCTGCAGCCCCACCAGGCGG - Intergenic
985798655 5:1985875-1985897 AGCCCAGCAGATGCTCCAGGTGG + Intergenic
986136454 5:4984029-4984051 CCCCCAGCAGCCCCAGCAGGGGG + Intergenic
986579850 5:9254366-9254388 AGCCCAGCAGCCACCTGAGCAGG + Intronic
986645015 5:9908254-9908276 AGCACAGCAGCCTCTGCAGAGGG - Intergenic
988993044 5:36690141-36690163 AGCCCCGCAGCCCCTGCGGCGGG - Intergenic
995165164 5:109031096-109031118 AGCCCAGTACCACCTTCAAGGGG - Intronic
995391598 5:111646082-111646104 AGCCCTACAGCACCTTCAAGGGG - Intergenic
995465447 5:112446029-112446051 AAGCCAGCTGCCCCTTCAAGAGG - Intergenic
995497495 5:112762430-112762452 AGCCCAGATGCCCCTTTAAGAGG + Intronic
995534101 5:113118489-113118511 AGTCCAGCTGCCCCTTCAGTAGG - Intronic
996606290 5:125327531-125327553 CACCCAGCAGCCCCTGCAAGTGG - Intergenic
997366903 5:133331485-133331507 ACCCCAGGAGCCCCTTCCGCAGG - Intronic
997601959 5:135146273-135146295 GGCCCTGAAGCCCTTTCAGGAGG - Intronic
998474332 5:142407947-142407969 ATCCCAGCAGAGCCTCCAGGTGG + Intergenic
998530571 5:142880688-142880710 TGCCCAAAAGCCCCTGCAGGTGG - Intronic
998601128 5:143586338-143586360 AGCACAGGAGTCCCTTCAGGGGG + Intergenic
999082362 5:148856466-148856488 AGCCAAGTAGCCTCTTGAGGTGG + Intergenic
999429276 5:151512107-151512129 ATCCCAGAAGGCTCTTCAGGTGG - Intronic
999685154 5:154096161-154096183 AGCCAAGCAACATCTTCAGGAGG + Intronic
999976672 5:156918474-156918496 AGCCCAGCTGCTCAATCAGGAGG + Intergenic
1000101002 5:158016145-158016167 AACCCAGCAACCCCATCAGTGGG - Intergenic
1000551324 5:162668603-162668625 TGCCCAGCAGCCCCCTTAGAGGG + Intergenic
1001589926 5:172858237-172858259 TGTCCAGCAGCCGCTTCAGCCGG - Intronic
1001597443 5:172907171-172907193 TGCACAGCAGCCCCTCCAGTGGG + Intronic
1001797438 5:174514098-174514120 AGCCCAGGATGCCCTTGAGGGGG - Intergenic
1003448216 6:6204897-6204919 AGGCCAGCAGTCCAGTCAGGTGG + Intronic
1004955424 6:20723243-20723265 AGCTCAGCTGGCCCTTGAGGTGG - Intronic
1005005929 6:21287604-21287626 AGCCCAGAAGCTCCCTCATGAGG - Intergenic
1006456434 6:34134615-34134637 AACCCAGCAGCCCCTGCATGAGG + Intronic
1007332777 6:41126737-41126759 AGCCCAGCAGAACCTTAAGGAGG + Intergenic
1013429227 6:110040995-110041017 AGCCCAGCAGGCCCCTAAGATGG - Intergenic
1014714294 6:124846525-124846547 AGGCCACCACCCGCTTCAGGTGG - Intergenic
1015442437 6:133264242-133264264 ACCCCTGGAGCCCCTTCAAGGGG + Intronic
1016886354 6:148963324-148963346 AACCCTGCAGGCCCCTCAGGAGG + Intronic
1018624182 6:165761427-165761449 AGTCCAGCAGCCCCTCCATGCGG + Intronic
1018827055 6:167416044-167416066 AGCCCACCAGCCCCCCCACGCGG - Intergenic
1019316881 7:391009-391031 AGCCCCCCAGCCCTCTCAGGAGG - Intergenic
1019436971 7:1027560-1027582 AGGCCGGCAGCTCCTTCAAGAGG - Intronic
1019735349 7:2647531-2647553 AGCCCAGCAGCGTCTCCAGCAGG - Exonic
1020082603 7:5294952-5294974 AGCCCAGCACCCCCTCCCCGGGG - Intronic
1020135787 7:5587145-5587167 AGTCCAGGAGGGCCTTCAGGAGG - Intergenic
1020727245 7:11831690-11831712 AGCCCACCAGCTCCTTAATGTGG + Intronic
1020841968 7:13229224-13229246 AGCCCAGGATGCCCATCAGGAGG + Intergenic
1021135456 7:16959764-16959786 AGCCCAAAAGCTCCTTCAGCTGG - Intergenic
1022183863 7:27948079-27948101 AGCCCAGCAGCACCGTCCAGTGG - Intronic
1022359250 7:29643114-29643136 AGCCCAGGACCTCCTTGAGGAGG - Intergenic
1022389486 7:29930831-29930853 AGCCCAGCAGCCAGTTCATGAGG + Intronic
1024208270 7:47182257-47182279 AGCCTATCAGCCCCTTCACCAGG + Intergenic
1025963182 7:66242724-66242746 AGACCACCAGCCTCTTCAGTAGG + Intronic
1030886438 7:114944244-114944266 TCCCCAGCAGCCCTTTCAGAGGG - Intronic
1031515239 7:122691486-122691508 AGCCAAGCAGGCTCTTCAGTAGG - Intronic
1032474110 7:132200624-132200646 AGCAAAGCAGCCCCTTGGGGTGG - Intronic
1032563698 7:132918349-132918371 CTCCCAGCAGCCCATTGAGGAGG - Intronic
1032819382 7:135510295-135510317 AGTCCAGCAGCCACGTGAGGTGG - Intergenic
1034057458 7:148050189-148050211 ACCTCAGCAGGTCCTTCAGGAGG + Intronic
1034172137 7:149070944-149070966 TGAGCAGCTGCCCCTTCAGGCGG + Exonic
1034269966 7:149798687-149798709 AGGACAGCAGGCCCTCCAGGAGG - Intergenic
1034488387 7:151380410-151380432 AGTGGAGCAGCCCCTTCAAGTGG - Intronic
1034534644 7:151719352-151719374 AGCCCAGCTCCCCCAGCAGGAGG - Intronic
1037306556 8:17510729-17510751 GGCCCAGCAGTCCCATCATGGGG + Intronic
1038439519 8:27561635-27561657 ATCCCAGGAGCCACTTGAGGAGG - Intergenic
1039031753 8:33317012-33317034 GGCCCAGCAGGCCCTTAAGAAGG - Intergenic
1040015515 8:42696129-42696151 AGACCACCAGCTCCTGCAGGAGG - Intergenic
1040309474 8:46229311-46229333 AGCCCAGCCACGCCATCAGGCGG - Intergenic
1044706603 8:95014952-95014974 AGCCAAACAGCACTTTCAGGGGG - Intronic
1045300881 8:100908741-100908763 TTCACAGCAGCCGCTTCAGGCGG + Intergenic
1047227252 8:122967431-122967453 AGCCCAGCAGCCCCACTGGGTGG - Intronic
1049259149 8:141629514-141629536 AGTCCAGCAGGCCCTGCAGAGGG - Intergenic
1049374083 8:142280860-142280882 AGCCCAGCAGGCCCTGTATGGGG + Intronic
1049432041 8:142569698-142569720 TGTCCAGCAGCCCCATCAGCTGG + Intergenic
1049769664 8:144374022-144374044 AGCCCAGCAGGCCCTGCGGGAGG - Intronic
1050024509 9:1320011-1320033 AGCAAAGAAGCCCCTTCAGCAGG - Intergenic
1050797156 9:9559514-9559536 AGCCAAGCAGCCTATTCAGTAGG - Intronic
1051867376 9:21696708-21696730 GGCCCAGCAGCCCCAGCAGCCGG + Intergenic
1053294701 9:36904308-36904330 GGCCCAGCAGCCTATTTAGGGGG - Intronic
1053924565 9:43039160-43039182 ATCCCAGCAGCACCTTTGGGAGG + Intergenic
1055508267 9:76970311-76970333 AGCCCAGCTGTGCCTTTAGGAGG - Intergenic
1056718406 9:89053103-89053125 AGCCCTGTGGCTCCTTCAGGAGG - Intronic
1057298347 9:93862150-93862172 AGCCCACCAGCTCCTCCTGGAGG + Intergenic
1059280814 9:113132151-113132173 AGCCCAGCACTCCTCTCAGGCGG - Intergenic
1061161887 9:128900183-128900205 AGGCCAGCAGCAGTTTCAGGTGG - Intronic
1061187473 9:129063238-129063260 AGCCCAGCAGCTCCGTCCTGAGG - Exonic
1061509563 9:131052336-131052358 TGCACAGCAGACCCTGCAGGGGG - Intronic
1062109307 9:134773290-134773312 AGCCCAGCAGGCCCCGCAGGAGG - Intronic
1062278783 9:135742901-135742923 AACCCAGCATCCCCTGCAGCTGG + Intronic
1062380678 9:136285251-136285273 AGGCCCGCAGCCAGTTCAGGGGG + Intronic
1062422467 9:136489712-136489734 AGCCTGGCGGCCCCTTCAGCAGG - Intergenic
1062565515 9:137162394-137162416 CGCCCCGCAGCCCCTTCGGCCGG + Exonic
1062638996 9:137507300-137507322 AGCGCAGCAGCCCCTTTACCTGG + Intronic
1186448768 X:9654710-9654732 TGCCTAGCAGCCCATTTAGGGGG - Intronic
1189276111 X:39787314-39787336 AGCCCAGGATGCCCTTGAGGGGG + Intergenic
1189973390 X:46439888-46439910 AGCCCAGGATGCCCTTGAGGGGG + Intergenic
1190723556 X:53171527-53171549 ATCCCAGCAGCACCTCCTGGTGG + Intergenic
1191815106 X:65235515-65235537 AGCCCAGCAGGCCCTGAGGGAGG - Intergenic
1195065882 X:101237715-101237737 AGCTCAGCTGCCCCTACAGGGGG + Exonic
1198380455 X:136078427-136078449 AGCCCAGGATGCCCTTGAGGGGG - Intergenic
1201763828 Y:17562508-17562530 TGCCCAGCAGCCCCTGCACCGGG - Intergenic
1201837725 Y:18343482-18343504 TGCCCAGCAGCCCCTGCACCGGG + Intergenic