ID: 1130445615

View in Genome Browser
Species Human (GRCh38)
Location 15:83998610-83998632
Sequence GGGATTTGAACAGCCTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130445615 Original CRISPR GGGATTTGAACAGCCTTAGA TGG Intronic
904350668 1:29903466-29903488 GGGATGTGCACAGGCTTTGAAGG - Intergenic
905342050 1:37286046-37286068 TGGATTTGAAAAGCCCTAAATGG + Intergenic
906561951 1:46764750-46764772 GGGCTTGGAGCAGCCTCAGATGG - Intronic
907995915 1:59632548-59632570 GGGATTTGTACAGCCTTTAATGG - Intronic
912739826 1:112183787-112183809 GGAATTTAGACAGCCATAGATGG - Intergenic
916662295 1:166934121-166934143 GGCATTTGAACAGGATTACAGGG - Intronic
918347919 1:183622774-183622796 GGGAATTTATCAGCCTTAGGTGG - Intergenic
924407835 1:243770285-243770307 GGGGTAGGAAAAGCCTTAGAGGG + Intronic
1064566950 10:16649947-16649969 GGAATTTGAAGAGTTTTAGATGG - Intronic
1065160894 10:22920330-22920352 GGGATTGGAAGAGCCTACGATGG - Intergenic
1070051927 10:72897937-72897959 GAAAGTTGAACAGACTTAGAAGG - Intronic
1073574969 10:104614771-104614793 TGCTTTTGAACAGCATTAGAAGG + Intergenic
1078463542 11:11533426-11533448 GGCATTGGAACAGGCTTGGAGGG - Intronic
1091425896 12:389154-389176 GGGACTTGAACGGGCTTAGTGGG - Exonic
1092502991 12:9065799-9065821 GGGATTTTATGAGCCTCAGAGGG - Intergenic
1094823445 12:34246456-34246478 GGGATTTCAAAAGGCTCAGATGG + Intergenic
1095091255 12:38108632-38108654 GGGATTTCAAAAGGCTCAGATGG - Intergenic
1100721505 12:97363659-97363681 GGGATTTCAAGTGACTTAGATGG + Intergenic
1100857835 12:98773899-98773921 GGGATTTGAAGAGCCTCATTGGG - Intronic
1103918974 12:124389697-124389719 GGGATTTGAGGAGCCTTTGCAGG + Intronic
1104497481 12:129254642-129254664 GGGATTTGCTTATCCTTAGAGGG + Intronic
1107849326 13:44554842-44554864 GGGAGTTGAAGACCATTAGAAGG - Intronic
1108266358 13:48712879-48712901 GGAGTTTGAAAAGCCTCAGAAGG + Intergenic
1111001262 13:82186224-82186246 GGGATTTGAACAGAGCTACATGG - Intergenic
1111893835 13:94116529-94116551 GGGCTTTGGACAGCCATACATGG - Intronic
1117733196 14:58744569-58744591 GGCATTTATTCAGCCTTAGAGGG - Intergenic
1121680581 14:95789702-95789724 GGGGTTTTGACAGCCTGAGAAGG + Intergenic
1122101548 14:99414339-99414361 GGGATTTGAACCCTCTCAGAAGG - Intronic
1122865444 14:104601917-104601939 GGGATTTAGGAAGCCTTAGACGG - Intronic
1123928628 15:25144743-25144765 GTGCTTTGAAGAGCCTTTGACGG + Intergenic
1130445615 15:83998610-83998632 GGGATTTGAACAGCCTTAGATGG + Intronic
1130801848 15:87272859-87272881 GGGTTTTAAACATTCTTAGAAGG - Intergenic
1137381185 16:48001306-48001328 GGCATTTCAATAGCCTCAGACGG + Intergenic
1140919496 16:79524079-79524101 GGGATTTGAGGAGCTTTTGAAGG + Intergenic
1145392999 17:22470506-22470528 GGGATGGGAACAGCTTTTGAGGG - Intergenic
1146814019 17:35927998-35928020 GGGTGTTGAACAGGCTAAGAGGG + Intronic
1149586142 17:57788397-57788419 GGGCTTTGAGAAGCATTAGAAGG + Intergenic
1156970536 18:43148968-43148990 TTGATCTGAACAGCTTTAGAGGG - Intergenic
1160222957 18:76990491-76990513 GGGATTTGATCAGATTTGGAGGG + Intronic
1160749200 19:726067-726089 GGGATTTGAACCGCGTCTGACGG + Intronic
1161269849 19:3383793-3383815 GGCAGTTGCACAGCCTGAGAGGG + Intronic
1164391916 19:27831239-27831261 GGGATTTCAAAAGGCTCAGATGG - Intergenic
1168625313 19:57913443-57913465 GGGCTTTAAACAGCATTAGATGG - Intronic
925445757 2:3925356-3925378 GGGATTTGAACATCTTTGGGAGG + Intergenic
925642902 2:6004295-6004317 TGAATTTGACCAGCTTTAGAAGG - Intergenic
926871105 2:17418269-17418291 GAGATTAGAACAGCCTGGGAAGG + Intergenic
927516690 2:23675648-23675670 TGGCTTTGAAGAGCCTTAAATGG - Intronic
930414752 2:51077375-51077397 GGGAGATGAACAGCATTTGAAGG + Intergenic
931889150 2:66651006-66651028 GGGATTCCACCAGTCTTAGAAGG - Intergenic
932108093 2:68967449-68967471 AGGATTTGAACAGCCACTGAAGG + Intergenic
932448829 2:71796754-71796776 GGGGTTTGTGCAGCCTTAGCTGG - Intergenic
933135840 2:78734186-78734208 AGGATTTGAACATCTTTAGTGGG - Intergenic
937104220 2:119294972-119294994 GGGGGTTGAAGAGCCTTGGAGGG + Intergenic
937241154 2:120463500-120463522 GGGGTATGAACAGACATAGATGG - Intergenic
937256442 2:120559301-120559323 GGTCTTTGGACAGCTTTAGATGG - Intergenic
940313319 2:152302128-152302150 TGGATTTGACCACCCTTAAATGG + Intergenic
945906756 2:215602619-215602641 ATGATTTGAACAGTGTTAGAAGG - Intergenic
947340218 2:229130508-229130530 GTGATTTGAACAGCCACTGAGGG + Intronic
948713009 2:239836831-239836853 GGGCTTTTAAGAGCCTCAGAGGG - Intergenic
1170990198 20:21294225-21294247 GGGATTTGAACAGGCCTTGATGG - Intergenic
1173036562 20:39417237-39417259 TGGATGTGAACAGCCTTGAAGGG + Intergenic
1173337333 20:42123495-42123517 GGGAATTGAACAGCCAAGGAGGG + Intronic
1175024808 20:55890564-55890586 GGGATATGAAAAGAATTAGATGG + Intergenic
1176317713 21:5263744-5263766 GGGATTTCAAAAGGCTCAGATGG - Intergenic
1176475578 21:7200519-7200541 GGGATTTCAAAAGGCTCAGATGG - Intergenic
1177771029 21:25516019-25516041 GGAATTTGCACAGCCTTAAGAGG - Intergenic
1178015464 21:28340916-28340938 GTGTTTTGAAGAGCATTAGAAGG + Intergenic
1178926021 21:36775665-36775687 GAGATCTGAACAGCCTGAAAAGG - Intronic
1180395389 22:12328104-12328126 GGGATTTCAAAAGGCTCAGATGG - Intergenic
1180404356 22:12536648-12536670 GGGATTTCAAAAGGCTCAGATGG + Intergenic
950139023 3:10602267-10602289 GGGATGTGAGCAGCCTGACAAGG - Intronic
950616077 3:14159142-14159164 GGGATTTGGACAGCCAAACATGG + Intronic
950745116 3:15081899-15081921 GGCATTTGGACAAACTTAGAAGG + Intronic
951696146 3:25447593-25447615 GGGTTTTGAACAGCAATTGAAGG + Intronic
955160287 3:56458756-56458778 GGGAATGTTACAGCCTTAGAAGG + Intronic
956919088 3:73907271-73907293 GCAATTTGAACAGCCATAAAAGG + Intergenic
957169646 3:76721988-76722010 GTGATTTGAAAAGACTTAGGTGG + Intronic
957688066 3:83529717-83529739 GGGATTTGATCATTCTTTGATGG + Intergenic
959063033 3:101633064-101633086 GGAATATGAACAGAATTAGAGGG - Intergenic
959870673 3:111323831-111323853 TTGATTTGAAGAGTCTTAGAAGG - Intronic
961189368 3:124945070-124945092 GGTATTTAAACAGCCTTTGGAGG + Intronic
972620565 4:40744501-40744523 AGGATTTGAAGAGACTGAGAAGG - Intergenic
972754111 4:42026679-42026701 GGGCTTTTAACAGCCATACAAGG - Intronic
974091267 4:57314009-57314031 GGGAGGTGAACTGCCTTAGCAGG - Intergenic
981152021 4:141390054-141390076 GGGATATGAACATCTTTGGAGGG + Intergenic
991307512 5:65195056-65195078 GGCATTTGATCAGCCTGTGAAGG - Intronic
993777997 5:92026025-92026047 GGTATGTGAACAGCTTTGGAGGG + Intergenic
999608920 5:153348380-153348402 GGGATTGGAAGAATCTTAGATGG - Intergenic
1003429091 6:6022532-6022554 GGGCTTTGAACAGCTGTGGATGG + Intergenic
1004311812 6:14552773-14552795 GGGATTTGAAAAGCAGTGGATGG - Intergenic
1012938756 6:105395777-105395799 TGGATTTCTACAGCCTTTGATGG - Intronic
1014225477 6:118841646-118841668 GTGATTCTAACAGCCCTAGAAGG - Intronic
1015657541 6:135536298-135536320 TGGATTTGAGCAACCCTAGATGG - Intergenic
1015945824 6:138499817-138499839 GGGATTTGAACTGATTTAGGGGG + Intronic
1015973037 6:138761890-138761912 AGGTTTTGAAAAGGCTTAGATGG + Intronic
1017029795 6:150211027-150211049 AGGATTTGAACAGGTTTAGAGGG - Intronic
1018681127 6:166266521-166266543 TGGATTTGAAGGGCCTTATAAGG - Intergenic
1020565028 7:9784800-9784822 GAGATTTGAAAAGCGTTAGCAGG + Intergenic
1021097273 7:16548033-16548055 GGGATTTCATGGGCCTTAGAGGG - Intronic
1022316121 7:29247125-29247147 GGGATTTCATCAGGCTGAGAAGG + Intronic
1024432032 7:49300111-49300133 GGCAATTGAACAGCCTGCGAAGG - Intergenic
1028674239 7:93440645-93440667 GGGATTTGCACTTCCGTAGATGG - Intronic
1033612303 7:142975506-142975528 GTAATTTGAATAGCCTTAAAAGG + Intergenic
1034828987 7:154292655-154292677 GGGATCTGAACATTCTTAAAAGG + Intronic
1037474264 8:19240942-19240964 GGGGTTTGACCAGCTTTAGAAGG - Intergenic
1038114785 8:24541392-24541414 AGGATTTGAGCAGCATTGGAAGG - Intergenic
1038279431 8:26150347-26150369 GGGAGGTGACCAGTCTTAGAGGG - Intergenic
1047503836 8:125463282-125463304 GGGAATTGAACTGACTCAGAAGG + Intergenic
1048406793 8:134131198-134131220 GGGACTTGAGCATCCTCAGATGG + Intergenic
1048769993 8:137884937-137884959 GAGATTTAAACTGCCTTTGAAGG + Intergenic
1048842846 8:138580339-138580361 GGGCTATGAACACCCTTAGACGG - Intergenic
1052727240 9:32244037-32244059 AAGATTTGAAGAGACTTAGATGG + Intergenic
1055769682 9:79703893-79703915 GGGATTTGAGCAACCAAAGATGG - Intronic
1056439215 9:86603747-86603769 GGGATTTGAAGAGTCAAAGATGG + Intergenic
1203411012 Un_KI270579v1:3208-3230 GGGATTTCAAAAGGCTCAGATGG - Intergenic
1186011317 X:5137269-5137291 GGGATATTTACAGCCTTACAGGG + Intergenic
1189042096 X:37553629-37553651 GGGATTTAAACAGCATGAGGTGG - Intronic
1194685147 X:96904998-96905020 GGGAATAGAACACCATTAGAGGG + Intronic
1198969038 X:142259809-142259831 GGGATATGAACAGCTTTGGGAGG - Intergenic