ID: 1130445905

View in Genome Browser
Species Human (GRCh38)
Location 15:84001732-84001754
Sequence CATACCATGGGGCAGTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130445905_1130445916 19 Left 1130445905 15:84001732-84001754 CCTGAGGACTGCCCCATGGTATG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1130445916 15:84001774-84001796 TGGGAGCCTGGCCTCTTGCTGGG 0: 1
1: 0
2: 2
3: 31
4: 256
1130445905_1130445912 0 Left 1130445905 15:84001732-84001754 CCTGAGGACTGCCCCATGGTATG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1130445912 15:84001755-84001777 AGATCCAGGGAGAGTACACTGGG 0: 1
1: 0
2: 0
3: 7
4: 141
1130445905_1130445911 -1 Left 1130445905 15:84001732-84001754 CCTGAGGACTGCCCCATGGTATG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1130445911 15:84001754-84001776 GAGATCCAGGGAGAGTACACTGG 0: 1
1: 0
2: 0
3: 15
4: 216
1130445905_1130445915 18 Left 1130445905 15:84001732-84001754 CCTGAGGACTGCCCCATGGTATG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1130445915 15:84001773-84001795 CTGGGAGCCTGGCCTCTTGCTGG 0: 1
1: 0
2: 3
3: 44
4: 355
1130445905_1130445914 7 Left 1130445905 15:84001732-84001754 CCTGAGGACTGCCCCATGGTATG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 1130445914 15:84001762-84001784 GGGAGAGTACACTGGGAGCCTGG 0: 1
1: 0
2: 0
3: 16
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130445905 Original CRISPR CATACCATGGGGCAGTCCTC AGG (reversed) Intronic
900092871 1:928003-928025 CCTTCCAAGGGGCAGTCTTCTGG + Intronic
900266874 1:1761853-1761875 CATGGGATGGGGGAGTCCTCGGG - Intronic
900767160 1:4513243-4513265 CATCCCAGGGGGCACTTCTCAGG + Intergenic
901153529 1:7120621-7120643 CATACCCTGGTGCAGTCCCTTGG - Intronic
905913789 1:41671480-41671502 CCTGCCATGGGGAAGGCCTCAGG + Intronic
909789680 1:79659916-79659938 CATTCCATGGGGCAGGCCAGGGG + Intergenic
913103518 1:115592088-115592110 CATACTATGGGACACTCCTTTGG + Intergenic
913169259 1:116217660-116217682 CCTTCCCTAGGGCAGTCCTCAGG - Intergenic
915261251 1:154678267-154678289 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
915952530 1:160199036-160199058 CTTACCAGGGGGAAGTCATCAGG - Exonic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
919869036 1:201806546-201806568 CATCCCATGAGGCAGTGCTATGG + Intronic
922855820 1:228773934-228773956 CTTCCCACGGGGCAGGCCTCGGG + Intergenic
1063931223 10:11030224-11030246 TATACCATGGGCCAGCCATCAGG + Intronic
1070279153 10:75036392-75036414 CTTACCATGAGGGAGTCCCCGGG + Intergenic
1070675783 10:78410369-78410391 AGTACCATGGGACAGGCCTCTGG + Intergenic
1070789449 10:79180704-79180726 CAGACAATGGGGCAGCCCACAGG + Intronic
1071900978 10:90119958-90119980 CTTCCCATGGGGCAGGGCTCAGG - Intergenic
1077385263 11:2266661-2266683 CAGCCAATGGCGCAGTCCTCAGG - Intergenic
1078721542 11:13889366-13889388 CATAACATGGGACTGTCCTGTGG + Intergenic
1080557668 11:33431874-33431896 CTTCCCGTGGGGCAGTCCTTGGG - Intergenic
1083059631 11:59856415-59856437 CATCCCTTAGGGCATTCCTCTGG - Intronic
1083546136 11:63550435-63550457 CTTCCCAGGGGGCAGGCCTCGGG + Intergenic
1092366582 12:7881512-7881534 CTTCCCATGGGGCAGGGCTCAGG + Intronic
1093527061 12:20115360-20115382 CTTCCCATGGGGCAGGGCTCGGG - Intergenic
1098156071 12:67600051-67600073 CATAACTTGGGGGAGGCCTCGGG - Intergenic
1099559595 12:84155252-84155274 CTTTCCATGGGGCAGGGCTCGGG - Intergenic
1105876661 13:24560836-24560858 CTTCCCACGGGGCAGGCCTCTGG - Intergenic
1106701385 13:32232717-32232739 CATCCCATGGGCCAGAACTCGGG + Intronic
1106810975 13:33358210-33358232 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
1109563142 13:64077668-64077690 CTTCCCATGGGGCAGGGCTCGGG - Intergenic
1114429173 14:22645704-22645726 CCAAACATGGGGCACTCCTCAGG + Intergenic
1114560283 14:23585012-23585034 CTTCCCATGGGGCAGGACTCGGG - Intergenic
1117178999 14:53173500-53173522 CATACCAAGGGGAGGTCCTAAGG - Intergenic
1117571899 14:57056746-57056768 CTTACCACGGGGCAGGGCTCGGG - Intergenic
1118493871 14:66288633-66288655 CATGCCCTGAGGCAGGCCTCTGG + Intergenic
1121320630 14:92989685-92989707 CATTCCCTGGTGCAGGCCTCGGG - Intronic
1125607535 15:40949727-40949749 CATACTCTGGGGAAGTGCTCAGG + Intergenic
1128500421 15:68223372-68223394 CAGACCACTGAGCAGTCCTCAGG - Intronic
1130251649 15:82303934-82303956 TATAGCTTGGGTCAGTCCTCAGG + Intergenic
1130445905 15:84001732-84001754 CATACCATGGGGCAGTCCTCAGG - Intronic
1135715170 16:24758493-24758515 CATACCCTGGGGTCGTCCTTTGG + Intronic
1135851659 16:25969291-25969313 CAAAACATGGGGCAGTTCCCTGG + Intronic
1141742901 16:85905909-85905931 TATACCATGAGGCCGGCCTCAGG - Intronic
1142551815 17:745441-745463 CATGCCTTGGTGCAGCCCTCAGG - Exonic
1149369553 17:55979366-55979388 CATATCACGGGGGAGGCCTCGGG + Intergenic
1150772308 17:68052102-68052124 CTTCCCACGGGGCAGGCCTCGGG + Intergenic
1151447315 17:74175790-74175812 CTTCCCATGGGGCAGACCTGGGG - Intergenic
1161014746 19:1978128-1978150 CAGGCCATGGTGCAGTGCTCTGG + Intronic
1163817081 19:19473236-19473258 CAGACCATGGGGCAGGCCTTTGG - Intronic
1166823630 19:45595984-45596006 CTTTCCATGGGAAAGTCCTCTGG + Intronic
936075996 2:109402248-109402270 GCTGCCATGGGCCAGTCCTCAGG - Intronic
939777334 2:146403822-146403844 CTTCCCATGGGGCAGGGCTCGGG - Intergenic
940283630 2:152011900-152011922 CATAGCATGAGGCATTACTCAGG + Intronic
942487205 2:176452225-176452247 CACACCATGGAGCAGTCTCCAGG + Intergenic
1170511200 20:17078599-17078621 CATACCAAAGGGCAGTGGTCAGG + Intergenic
1171105997 20:22432971-22432993 CAACCCAGGGGGCTGTCCTCAGG + Intergenic
1172943505 20:38670911-38670933 CATTTCATAGGGCAGTTCTCAGG - Intergenic
1176179594 20:63743063-63743085 CAGCCCCTGGGGCTGTCCTCGGG - Exonic
1177906888 21:26982545-26982567 TATACCATGGGACAGAACTCAGG + Intergenic
1178891014 21:36521254-36521276 CTTCCCTTGGGGCAGTCCACTGG - Intronic
952101720 3:30021031-30021053 AATAACATGAGGCAGTCTTCTGG - Intergenic
952398255 3:32939913-32939935 CTTCCCACGGGGCAGGCCTCGGG + Intergenic
953307585 3:41844299-41844321 CTTCCCATGGGGCAGGGCTCGGG - Intronic
962945076 3:140161037-140161059 CCTACCATGTGCCAGGCCTCAGG + Intronic
963583366 3:147154316-147154338 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
968216750 3:196898295-196898317 CACACCATAGGACAGTCTTCAGG - Intronic
969654950 4:8491540-8491562 CTTTCCATGGGGCAGGGCTCGGG - Intronic
970189583 4:13500815-13500837 TATACAATCAGGCAGTCCTCAGG - Intergenic
971792328 4:31185097-31185119 CCCACCATGGGGCAGGGCTCGGG - Intergenic
972034777 4:34506751-34506773 CTTACCATGGGGCAGGGCTGGGG - Intergenic
973855332 4:55005447-55005469 CATACCAAGGGACAGTTCTCAGG + Intergenic
975755895 4:77570894-77570916 CTTCCCATGGGGCAGGCCTCGGG + Intronic
976406405 4:84664921-84664943 CTTACCATGGGGCAGGGCTCGGG + Intergenic
980051904 4:128047688-128047710 CTTCCCGTGGGGCAGGCCTCGGG - Intergenic
980230230 4:130038675-130038697 CTTCCCACGGGGCAGGCCTCGGG - Intergenic
983832416 4:172344296-172344318 AATACTATAGGGCAGTCATCTGG + Intronic
983834218 4:172369600-172369622 CTTCCCATGGGGCAGGGCTCGGG - Intronic
990473845 5:56142720-56142742 CATGCCCTGGGGCTGGCCTCTGG - Intronic
990679603 5:58226884-58226906 CATACCATGGAAAAGTACTCAGG + Intergenic
998498322 5:142610425-142610447 CGTACCATGCAGCTGTCCTCAGG - Intronic
1000329162 5:160194026-160194048 CTTCCCATGGGGCAGGGCTCGGG - Intronic
1000958438 5:167570636-167570658 CATTCCAGGGGGCATTCCTAGGG - Intronic
1004912656 6:20301483-20301505 CTTACCGTGGGGCAGCGCTCGGG + Intergenic
1007428062 6:41759889-41759911 CCTACCAAGGGGCATCCCTCTGG - Intergenic
1011246547 6:85326200-85326222 CTTCCCACGGGGCAGGCCTCAGG + Intergenic
1011338335 6:86284948-86284970 CTTCCCATGGGGCAGGGCTCGGG - Intergenic
1012398401 6:98824991-98825013 CATTCCTTGGGGCAGTCCGCAGG - Intergenic
1014240769 6:119015555-119015577 CTTCCCACGGGGCAGGCCTCGGG + Intronic
1014499261 6:122165255-122165277 CTTCCCATGGGGCAGGGCTCAGG - Intergenic
1014718586 6:124892204-124892226 CTTCCCACGGGGCAGGCCTCGGG + Intergenic
1017755820 6:157528226-157528248 TTTGCCATGGGGAAGTCCTCAGG + Intronic
1018862733 6:167722809-167722831 CCTCCCCTGGGTCAGTCCTCTGG - Intergenic
1019929756 7:4215632-4215654 CGTACCGCGGGGCAGTCCTTTGG - Intronic
1021567405 7:22028871-22028893 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
1022620385 7:31977902-31977924 CTTACTATGGGCCAGTCCTTGGG + Intronic
1023159669 7:37284962-37284984 TATTCCATGGGGAAGGCCTCAGG + Intronic
1023913170 7:44569451-44569473 AATACCATGGGGTACTCCTTGGG - Intronic
1024012465 7:45281103-45281125 CATACCATGGGATATTGCTCAGG + Intergenic
1024335611 7:48203042-48203064 CTTCCCGTGGGGCAGGCCTCGGG - Intronic
1028106402 7:86884359-86884381 CTTACCATGGGGCATACCTAAGG - Intronic
1028142525 7:87288955-87288977 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
1028428892 7:90723450-90723472 CATGCCATGAGGCAGCCCTGTGG - Intronic
1034091072 7:148364039-148364061 CTTCCCATGGGGCAGGGCTCGGG + Intronic
1035391517 7:158507728-158507750 CCTAGCATGGGGCTGTCCCCTGG - Intronic
1039637323 8:39180345-39180367 CTTCCCATGGGGCAGGCCTCCGG + Intronic
1040323972 8:46331920-46331942 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
1041361195 8:57055993-57056015 GATCCCATGGAGCAGTTCTCAGG + Intergenic
1043435348 8:80232039-80232061 CTTCCCACGGGGCAGGCCTCGGG + Intergenic
1049063877 8:140297655-140297677 CAGACCCTGGGGAAGCCCTCTGG - Intronic
1049469398 8:142768746-142768768 ATGACCCTGGGGCAGTCCTCAGG + Intronic
1049653415 8:143787298-143787320 GATAGCACAGGGCAGTCCTCAGG + Intergenic
1051760983 9:20464083-20464105 CAAACCTTGGGACAGCCCTCTGG + Intronic
1055300666 9:74878412-74878434 CATAAGATGGGCCAGTCCTTGGG - Intronic
1055933596 9:81584637-81584659 CATATCATGGACCAGTCCTTAGG - Intronic
1061976699 9:134071890-134071912 CCTACCAAGGTGCAGTCTTCTGG - Intergenic
1062011332 9:134268521-134268543 CAGCCCATGGGGCACTGCTCAGG - Intergenic
1062108007 9:134766204-134766226 CATTCCACGGGGCAGGCCTCAGG - Intronic
1062146190 9:134991162-134991184 CTTCCCACGGGGCAGGCCTCGGG - Intergenic
1187986954 X:24824241-24824263 CATACCATGGGGCCCTGCTCAGG + Intronic
1188189549 X:27157234-27157256 CTTCCCATGGGGCAGGCCTCCGG + Intergenic
1193804018 X:85972488-85972510 CTTCCCACGGGGCAGGCCTCGGG - Intronic
1194323794 X:92484527-92484549 CATACCATGGAACACTACTCAGG + Intronic
1195259350 X:103117241-103117263 CTTCCCATGGGGCAGGGCTCTGG - Intergenic
1195946892 X:110224110-110224132 CATAATATGGGGCAGCCCTGTGG - Intronic
1196582715 X:117394911-117394933 CTTCCCGTGGGGCAGGCCTCGGG + Intergenic
1196705891 X:118717067-118717089 CTTCCCACGGGGCAGGCCTCGGG - Intergenic
1200631894 Y:5597619-5597641 CATACCATGGAACACTACTCAGG + Intronic
1200824273 Y:7622347-7622369 CTTCCCATGGGGCAGGGCTCGGG - Intergenic
1200930204 Y:8690093-8690115 CATACCATGGGCCTGTGTTCAGG - Intergenic
1200962084 Y:9004979-9005001 CATACCATGGCCCAGTGTTCAGG + Intergenic
1202068181 Y:20962298-20962320 CATGCCACAGTGCAGTCCTCTGG - Intergenic
1202235780 Y:22708740-22708762 CTTCCCATGGGGCAGGGCTCGGG + Intergenic
1202307383 Y:23487428-23487450 CTTCCCATGGGGCAGGGCTCGGG - Intergenic
1202563422 Y:26183158-26183180 CTTCCCATGGGGCAGGGCTCGGG + Intergenic