ID: 1130447812

View in Genome Browser
Species Human (GRCh38)
Location 15:84020252-84020274
Sequence GACACACTTGGGATCCAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130447807_1130447812 24 Left 1130447807 15:84020205-84020227 CCTTGAACTGCCAAGGTGTCTTT 0: 1
1: 0
2: 2
3: 17
4: 207
Right 1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG 0: 1
1: 0
2: 1
3: 7
4: 108
1130447808_1130447812 14 Left 1130447808 15:84020215-84020237 CCAAGGTGTCTTTGTGAAATGTG 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG 0: 1
1: 0
2: 1
3: 7
4: 108
1130447806_1130447812 28 Left 1130447806 15:84020201-84020223 CCTGCCTTGAACTGCCAAGGTGT 0: 1
1: 0
2: 10
3: 518
4: 10405
Right 1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130447812 Original CRISPR GACACACTTGGGATCCAGTC CGG Intronic
901399575 1:9006783-9006805 GACACACTAGGGAAGGAGTCTGG + Intronic
901579089 1:10225699-10225721 GAAAAACTTGGGATGCATTCTGG + Intronic
903705633 1:25283791-25283813 GACAAACTTGGGTTCAAATCAGG - Intronic
904502949 1:30927509-30927531 AACACAATTTGGATCCAGTTAGG - Intergenic
906811360 1:48830251-48830273 GAAACACTTGGGATACTGCCTGG - Intronic
907153097 1:52306937-52306959 GACAGACATGGGATCCAGGCTGG + Intronic
911658956 1:100478147-100478169 GACACATTTGGGATTCAGAATGG - Intronic
915904840 1:159870215-159870237 GACACTCTTGAGAGCCAGGCAGG - Intronic
918659300 1:187070303-187070325 GACACACTTGAGATGCTGTACGG - Intergenic
920933286 1:210408552-210408574 GAGACCCTGGGTATCCAGTCTGG + Intronic
923974052 1:239239846-239239868 GACACACATGGTATCCAGTCTGG - Intergenic
923991962 1:239448014-239448036 GACAGACATGGATTCCAGTCTGG + Intronic
1062988280 10:1790420-1790442 GACACATTTGGGAACCAGGCAGG + Intergenic
1063368339 10:5504944-5504966 GACACACCTGGGAACCTGGCAGG + Intergenic
1075645554 10:124093665-124093687 GACACACATCAGCTCCAGTCTGG + Intergenic
1077611268 11:3644455-3644477 GAAGCACTGGGGATCCAGGCTGG - Intergenic
1080658258 11:34275022-34275044 GACTCACCTGGGCTCCAGGCTGG + Intronic
1080997839 11:37626050-37626072 GCCACGCTTGGGATACAGTGAGG + Intergenic
1083772231 11:64874444-64874466 GACACCCCCGGGATCCTGTCTGG - Exonic
1089764874 11:120756037-120756059 TACACTGCTGGGATCCAGTCAGG - Intronic
1090859022 11:130636609-130636631 GAAAGACTTTGGAGCCAGTCAGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1095194025 12:39291161-39291183 GACACAGTTGGAAGCAAGTCTGG + Intergenic
1098097615 12:66975890-66975912 GGCAAACTTGGGAATCAGTCTGG - Intergenic
1102850048 12:116233836-116233858 TAAACACTTGGGTTCCTGTCTGG - Intronic
1102918858 12:116776740-116776762 GAGACAGATGGGATTCAGTCTGG + Intronic
1105802696 13:23922654-23922676 GACACAATTGTGCCCCAGTCTGG - Intergenic
1106566909 13:30893603-30893625 CACACACTTGGGAGCCATTGGGG - Intergenic
1106884608 13:34170916-34170938 CACACTCTTGGGAGCCAGACTGG + Intergenic
1113886923 13:113665940-113665962 GACACACCTGGGATGCACTGGGG - Intergenic
1117132900 14:52704102-52704124 TAGACACTGGGGATCCAATCAGG + Intergenic
1118046154 14:61973913-61973935 GACAGATGTGGGACCCAGTCAGG + Intergenic
1118472976 14:66092852-66092874 GGCAGACGTGGGATCCAGGCCGG - Intergenic
1122829968 14:104391119-104391141 GGCACACTGGGGAGCCAGGCTGG - Intergenic
1127811659 15:62570257-62570279 GACACACTTGGAACCAAGCCAGG - Intronic
1128835955 15:70809395-70809417 CCCACACTTGGAATCTAGTCTGG - Intergenic
1130132341 15:81154488-81154510 TAGACACTGGGGATCCAGTGGGG + Intergenic
1130447812 15:84020252-84020274 GACACACTTGGGATCCAGTCCGG + Intronic
1131309759 15:91279136-91279158 GGGACACTTGTGATCCAGTTGGG - Intronic
1131950966 15:97681540-97681562 GAGACAGTTCGGAGCCAGTCAGG - Intergenic
1137357198 16:47778253-47778275 GACATACTTGTGATGCAGTGTGG + Intergenic
1138609167 16:58109300-58109322 GGCGCCCTTGGGATCCTGTCTGG - Intergenic
1143184110 17:5000305-5000327 CACACACTTGGCATCCTGGCTGG - Exonic
1143992549 17:10978802-10978824 GAGTCACTTGGAATCCAGTGTGG + Intergenic
1145215451 17:21048134-21048156 GACATACTTGGCATCTAGACAGG + Intergenic
1145843899 17:28021102-28021124 GACATACTTGGTATCAGGTCTGG + Intergenic
1150868733 17:68880781-68880803 GGCAGGCTTGGGATCCAGGCTGG + Intronic
1152403594 17:80083714-80083736 GACAGACTTTGGATCCCTTCTGG - Intronic
1157244326 18:46040176-46040198 GACCCACTTAGGAGCCTGTCAGG + Intronic
1158139312 18:54240876-54240898 GGCAGACATGGGATCCAGGCTGG - Intergenic
1166610542 19:44190012-44190034 GAATAACTTAGGATCCAGTCTGG + Intergenic
1166943680 19:46384182-46384204 GCCACACTTGGGTTCCATCCTGG + Intronic
1167035884 19:46994740-46994762 TACACACTGGGGATGCAGTAGGG - Intronic
926861901 2:17318610-17318632 GACACACCTGGGATTAAATCTGG + Intergenic
927303848 2:21547570-21547592 CAGACACTTGGGGTCCAGGCAGG + Intergenic
928217100 2:29370837-29370859 GTGAGACTTGGGATCCAGACAGG + Intronic
928435040 2:31249423-31249445 GACACACCAGGGATCCTCTCTGG + Exonic
931040632 2:58295061-58295083 GAGTCACTTGGGAGGCAGTCAGG + Intergenic
931119019 2:59196049-59196071 GACACACTTGGGTTTGTGTCCGG - Intergenic
935205586 2:100894037-100894059 GACGCACTTGGGACCCAGGGCGG + Intronic
936401307 2:112166541-112166563 GACCCACCTAGGAACCAGTCAGG + Intronic
937471630 2:122178796-122178818 GTCACCCTTGGGATCTAGGCAGG + Intergenic
947954744 2:234178933-234178955 GCCACACTGGGGAGCCATTCAGG - Intergenic
1170718891 20:18857822-18857844 GACTCATCTGGGTTCCAGTCTGG - Intergenic
1170721994 20:18889718-18889740 GGAACATTTGGGATCCACTCCGG + Intergenic
1172541482 20:35720793-35720815 GACCCACTTCTGATCCACTCTGG - Intronic
1175498102 20:59429109-59429131 GACCCACTTGGGTACCAGTCGGG + Intergenic
1181036669 22:20173059-20173081 GACACAATTGCACTCCAGTCTGG - Intergenic
1182093054 22:27609137-27609159 AACACACTTTGGAACCAGGCAGG - Intergenic
1182147670 22:28006717-28006739 GACACATTCGGGATCCATTGGGG - Intronic
1183685002 22:39356662-39356684 GCCACACTTGGCACCCAGACCGG + Intronic
952194983 3:31065819-31065841 GACACACTTGGGATACTGGGTGG - Intergenic
954409253 3:50363193-50363215 GACACAGCTGGCATCCAGGCCGG + Intronic
954647187 3:52138775-52138797 GACACTCTTAGGAAGCAGTCAGG + Intronic
956611930 3:71132843-71132865 AACACTCTTAGGATCCAGTAGGG - Intronic
963495238 3:146050925-146050947 GTCACATTTGGGGTCAAGTCTGG - Intergenic
967431983 3:189396481-189396503 TAATCACTTGGGATTCAGTCTGG - Intergenic
976120203 4:81772245-81772267 GACACTGTTGGTACCCAGTCTGG + Intronic
981099768 4:140817127-140817149 GACACAAGTGGAATCCATTCTGG + Intergenic
985530823 5:433121-433143 GACACACGTGACTTCCAGTCCGG - Intronic
988221949 5:28357393-28357415 GACACACTGGTGAACAAGTCAGG + Intergenic
992904760 5:81335143-81335165 GACAGACTTGGGTTCCAGTTTGG + Intronic
995218375 5:109620826-109620848 GACAGCCTTGAGATCAAGTCGGG - Intergenic
995264376 5:110140317-110140339 ATCACACATGGGAGCCAGTCGGG + Intergenic
1000767975 5:165316158-165316180 TTCACTCTTGGCATCCAGTCTGG + Intergenic
1001138071 5:169119068-169119090 GACAGATTTTGGATCCAGACAGG - Intronic
1003160907 6:3633534-3633556 GAGACACTTGGGGCCGAGTCTGG - Intergenic
1007637460 6:43307964-43307986 GACACACCTGGCAGCCTGTCTGG - Intronic
1009642318 6:66353815-66353837 GACTCACTTGGAATCTGGTCTGG - Intergenic
1012370248 6:98496476-98496498 CACAAACTTGGGATGGAGTCAGG + Intergenic
1016279045 6:142392595-142392617 GACAGACTTGGGTTCCAATCTGG + Intronic
1022479813 7:30735459-30735481 TACTCACTGGGGGTCCAGTCTGG - Intronic
1023054698 7:36282419-36282441 GACACAGTGGGGATCCCGGCTGG + Intronic
1029762906 7:102610622-102610644 GCCAGACTTGGGCTCCAGTGTGG + Intronic
1032465863 7:132144570-132144592 AACACACTTAGGAACCAGCCAGG - Intronic
1032658198 7:133954736-133954758 GACAGGCATGGGATCCAGGCCGG - Intronic
1033077291 7:138261563-138261585 GACACACCTGGGATATACTCAGG + Intergenic
1033591133 7:142809305-142809327 GACCCAGTTGGGATCCCTTCTGG + Intergenic
1037705079 8:21311276-21311298 GACCACATTGGGATCCAGTCCGG + Intergenic
1037705591 8:21313349-21313371 GACCCCCCTGGGATCCAGTCCGG + Intergenic
1037705685 8:21313737-21313759 GACCACATTGGGATCCAGTCCGG + Intergenic
1039019744 8:33191856-33191878 GATACTCTTGGCATCCACTCTGG - Intergenic
1042196693 8:66237392-66237414 GACAGGCGTGGGATCCAGGCTGG - Intergenic
1044312840 8:90714143-90714165 GGCACACTTTGGCTGCAGTCTGG + Intronic
1046137529 8:110048594-110048616 GGAACACTTGGGATCTAGTTTGG + Intergenic
1047771442 8:128033297-128033319 CACACACATGGGAACCAGGCAGG - Intergenic
1052623649 9:30945121-30945143 GACAGCCATGGAATCCAGTCTGG + Intergenic
1057236549 9:93366110-93366132 GACACACATGGGATCCCCTGTGG + Intergenic
1057263552 9:93599421-93599443 GACCCCATTGGGATCCAGGCAGG + Intronic
1057984093 9:99691969-99691991 TCCACACTTTGGATCCAATCAGG - Intergenic
1186930907 X:14388967-14388989 GACACACTTGGCATACATTAAGG - Intergenic
1187191436 X:17038915-17038937 GACAGACTTGGGTTCCAATTTGG - Intronic
1188007985 X:25030231-25030253 GACACTCATGGGAGCCAGTCAGG - Intergenic
1188895511 X:35663390-35663412 GACACACTTGGTTTCAATTCTGG + Intergenic
1189241361 X:39526974-39526996 GACAGATTTGGTGTCCAGTCAGG - Intergenic
1201958557 Y:19651978-19652000 GACACACTTGGGAGCAACACAGG - Intergenic