ID: 1130453956

View in Genome Browser
Species Human (GRCh38)
Location 15:84085334-84085356
Sequence GTGTGGGTTGGGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130453945_1130453956 23 Left 1130453945 15:84085288-84085310 CCACAGAGTAGATCCAGTAGACT No data
Right 1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG No data
1130453947_1130453956 10 Left 1130453947 15:84085301-84085323 CCAGTAGACTTGAAGGTCGATTT No data
Right 1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130453956 Original CRISPR GTGTGGGTTGGGAGGGAAGC TGG Intergenic
No off target data available for this crispr