ID: 1130454153

View in Genome Browser
Species Human (GRCh38)
Location 15:84088230-84088252
Sequence ATTTGTGAGGTGAAGTCCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130454146_1130454153 18 Left 1130454146 15:84088189-84088211 CCATGTCCATCAGTAATGCAATG No data
Right 1130454153 15:84088230-84088252 ATTTGTGAGGTGAAGTCCTACGG No data
1130454148_1130454153 12 Left 1130454148 15:84088195-84088217 CCATCAGTAATGCAATGGACGAA No data
Right 1130454153 15:84088230-84088252 ATTTGTGAGGTGAAGTCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130454153 Original CRISPR ATTTGTGAGGTGAAGTCCTA CGG Intergenic
No off target data available for this crispr