ID: 1130455078

View in Genome Browser
Species Human (GRCh38)
Location 15:84097738-84097760
Sequence GTCAAAACTGAGATGGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130455078_1130455084 18 Left 1130455078 15:84097738-84097760 CCTGACCCCATCTCAGTTTTGAC No data
Right 1130455084 15:84097779-84097801 CCACCCTTCACCTCTCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130455078 Original CRISPR GTCAAAACTGAGATGGGGTC AGG (reversed) Intergenic
No off target data available for this crispr