ID: 1130455992

View in Genome Browser
Species Human (GRCh38)
Location 15:84108902-84108924
Sequence TAGCAGAATGCTCACAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1130455992_1130455996 -3 Left 1130455992 15:84108902-84108924 CCTGATTTGTGAGCATTCTGCTA No data
Right 1130455996 15:84108922-84108944 CTAGTAAGCCACAAGGTGGGAGG No data
1130455992_1130455993 -10 Left 1130455992 15:84108902-84108924 CCTGATTTGTGAGCATTCTGCTA No data
Right 1130455993 15:84108915-84108937 CATTCTGCTAGTAAGCCACAAGG No data
1130455992_1130455994 -7 Left 1130455992 15:84108902-84108924 CCTGATTTGTGAGCATTCTGCTA No data
Right 1130455994 15:84108918-84108940 TCTGCTAGTAAGCCACAAGGTGG No data
1130455992_1130455995 -6 Left 1130455992 15:84108902-84108924 CCTGATTTGTGAGCATTCTGCTA No data
Right 1130455995 15:84108919-84108941 CTGCTAGTAAGCCACAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1130455992 Original CRISPR TAGCAGAATGCTCACAAATC AGG (reversed) Intergenic
No off target data available for this crispr